Search PubMed⌕ Search

Biomedical subjects

R J Warren

Publications and source records attributed to R J Warren.

At least 19 recordsLinked to original sources

The management of acute myocardial infarction. Does thrombolysis have a place?

BACKGROUND: Myocardial infarction is a common life threatening medical emergency. The mortality remains around 10% and can be influenced by early reperfusion achieved either by thrombolysis or angioplasty. OBJECTIVE: To outline the relative suitability and safety of thrombolysis as a treatment option for myocardial infarction. DISCUSSION: Initial assessment and treatment are vitally important in improving outcome. Later risk factor modification remains an important factor in reducing future cardiac events.

Angioplasty↗

Effects of applied currents on spontaneous epileptiform activity induced by low calcium in the rat hippocampus.

It is known that both applied and endogenous electrical fields can modulate neuronal activity. In this study, we have demonstrated that anodic current injections can inhibit spontaneous epileptiform events in the absence of synaptic transmission. Activity was induced with low-Ca2+ (0.2 mM) artificial cerebrospinal fluid (ACSF) and detected with a voltage threshold detector. At the onset of an event, a current was injected into the stratum pyramidale via a tungsten electrode positioned within 150 micron of the recording site. Data was recorded with a glass pipette electrode. The results show that spontaneous epileptiform activity can be fully suppressed by subthreshold anodic currents with an average amplitude of 3.9 microA and a minimum amplitude of 1 microA. In addition, we observed that some events could be blocked by current pulses with shorter durations than the duration of the event itself. The possibility that increased tissue resistance could contribute to the efficacy of the currents was tested by measuring the step-potential increase evoked by anodic current injections. The data show a significant increase in the amplitude of the evoked potential after introduction of a low-Ca2+ medium, suggesting that tissue resistance is increasing. These results indicate that low-amplitude, subthreshold current pulses are sufficient to block epileptiform activity in a low-Ca2+ environment. The increased tissue resistance induced by sustained exposure to a low-Ca2+ medium could contribute to the low current amplitudes required to block the epileptiform events.

Animals↗

Minimally invasive coronary artery bypass surgery without cardiopulmonary bypass.

OBJECTIVE: To report on the initial results of minimally invasive direct coronary artery bypass surgery (MIDCAB) without cardiopulmonary bypass. This is a potential alternative to conventional coronary artery bypass graft surgery, recently introduced to Australia. DESIGN: Prospective survey of patient data. SETTING: Royal Melbourne Hospital campus, Melbourne, Victoria, July 1996 to June 1997. PATIENTS: The first 23 consecutive patients to have a MIDCAB procedure without cardiopulmonary bypass via a small left thoracotomy. The left anterior descending coronary artery was revascularised with the left internal mammary artery. All patients had either recurrent stenosis after previous angioplasty or anatomy unsuitable for angioplasty. OUTCOME MEASURES: Operative morbidity and mortality; graft patency; and patient symptom relief and reoperation rates. RESULTS: Mean age of patients was 57.9 years (range, 29-81), and mean follow-up was 4.0 months (range, 1-10). There was no operative mortality, cardiac infarction or stroke. Mean postoperative stay in the Intensive Care Unit was 30.7 hours and in hospital, 5.3 days. Only one patient needed a blood transfusion (packed red cells). Initial patency of the grafts was confirmed by either angiography (five) or continuous pulse-wave Doppler (23). One patient underwent angioplasty for a stenosis distal to the anastomosis, and two patients (9%) required reoperation for recurrent angina. CONCLUSIONS: MIDCAB can be performed safely, and patient recovery is faster than after conventional coronary artery surgery.

Adult↗

Assessment of left ventricular function after radiofrequency and direct current atrioventricular node ablation.

BACKGROUND: There is limited information available regarding the effect of catheter ablation of the antioventricular (AV) junction on left ventricular (LV) function. Both deterioration and improvement in LV function have been reported following direct current (DC) ablation of the AV junction. The deterioration of LV function following DC ablation of the AV junction may be due to the accompanying barotrauma, DC arcing and direct coagulation, or even the effects of chronic ventricular pacing. If this deterioration of LV function was a result of the accompanying effects of DC shock, the use of radiofrequency ablation (RF) should not result in deterioration of LV function. AIM: To study LV function before and after different methods of AV junction ablation and in patients with chronic ventricular pacing without AV junction ablation. MATERIAL: This study assessed LV function in patients following RF ablation, low energy DC ablation of the AV junction and compared the results with our previously reported finding in patients who had AV junction ablation using high energy DC shock. A group of patients undergoing permanent single chamber ventricular pacemaker implantation without AV junction ablation were selected as controls. METHODS: All patients were paced in the ventricle at 110 beats/minute during LV function assessment by radionuclide angiography. Global LV function and segmental wall motion abnormalities were assessed before, immediately following and three months after ablation. RESULTS: In the high energy DC ablation group, a fall in global LV function (50 +/- 3.0% to 43 +/- 3.0%, p = 0.02) and impairment of segmental wall motion were detected. Low energy DC ablation resulted in segmental wall motion impairment similar to high energy DC but without affecting global ejection fraction (47.0% +/- 6.7 to 45.5% +/- 3.1, p > 0.05). Neither RF ablation (44.0% +/- 3.3 to 45.3% +/- 3.5, p > 0.05), nor chronic pacing (46.7% +/- 4.9 to 47.0% +/- 2.9 p > 0.05) had any effect on global or segmental LV function. CONCLUSIONS: Low energy DC or RF ablation of the AV junction does not affect global LV ejection fraction. The deterioration of global LV function after high energy DC shock ablation appears to be related to the accompanying effects of DC energy and not to the effects of chronic ventricular pacing.

Adult↗

Comparison of Pneumocystis carinii detection by toluidine blue O staining, direct immunofluorescence and DNA amplification in sputum specimens from HIV positive patients.

Pneumocystis carinii pneumonia (PCP) is the commonest opportunistic infection in AIDS patients. By using the polymerase chain reaction (PCR), specific DNA sequences can be amplified and used in diagnosis of infections such as PCP where the causative pathogen is both difficult to grow and present in low numbers. Twenty HIV positive patients were investigated for PCP. Twenty sputa (15 induced and 5 expectorated) had toluidine blue O staining, direct immunofluorescence and PCR performed for Pneumocystis carinii in a blinded fashion. PCR was performed using primers pAZ102-E 5' GATGGCTGTTTCCAAGCCCA 3' and pAZ102-H 5' GTGTACGTTGCAAAGTACTC 3' from the gene coding for Pneumocystis carinii mitochondrial ribosomal RNA with a specific 346 base-pair sequence being amplified from positive specimens. Ten of the patients had Pneumocystis carinii shown by conventional tests and PCR. Another 3 patients were positive only by PCR, all had evidence of infection with Pneumocystis carinii; the first was positive by subsequent conventional stains, the second was treated for bacterial bronchitis but had a non-resolving chest infection with PCP found on postmortem after 4 mths, the third had a typical interstitial infiltrate on CXR and responded to empiric PCP treatment. PCR is more sensitive than toluidine blue O staining and direct immunofluorescence in detecting Pneumocystis carinii in sputum from HIV patients and may become the diagnostic method of choice for PCP.

AIDS-Related Opportunistic Infections↗

Levonorgestrel implants as a contraceptive in captive white-tailed deer.

Silastic implants containing levonorgestrel (LNG) were evaluated as a contraceptive in captive white-tailed deer (Odocoileus virginianus). Six adult females and six female fawns received either six or nine implants in autumn. Each implant contained 36 mg of LNG. Blood was analyzed by radioimmunoassay to determine LNG release profile for 5 mo post-implantation. Serum LNG concentrations rose significantly (P = 0.0005) 3 days post-implantation, leveled off after 7 days, and did not change (P = 0.5913) during the remaining 5 mo. Mean (+/- SE) LNG concentrations for all months were higher (P = 0.0377) in adult and fawn females implanted with nine versus six rods (138.1 +/- 14.4 versus 56.7 +/- 12.3 pg/ml, respectively). Serum LNG levels did not differ between adults and fawns. Five of the six implanted adult females had normal estrous cyclicity; three of these five adult females became pregnant in the first year. Four implanted females (two yearlings and two adults) were monitored during a second year, and housed with a fertile buck; three of them became pregnant. We do not recommend the use of LNG in deer.

Animals↗

Comparative evaluation of cryptococcal latex tests.

One hundred and seven specimens (24 CSF and 83 sera) from 90 patients were tested for the presence of Cryptococcus neoformans antigen using the Fairfield Hospital in-house latex agglutination technique and the IMMY and Meridian commercial latex agglutination kits. Forty one specimens (14 CSF and 27 sera) from 27 patients with culture-proven cryptococcosis were positive by both the Fairfield and IMMY latex tests. Thirty nine of these specimens were positive by the Meridian latex test. Two were negative. Sixty six specimens (10 CSF and 56 sera) from 63 patients not known to have cryptococcosis were negative by all 3 tests.

Cryptococcosis↗

Infusion of atherogenic lipoprotein particles increases hepatic lipase activity in the rabbit.

Hepatic lipase plays a key role in the turnover of potentially atherogenic lipoprotein remnants and in determining the relative distribution of high density lipoprotein (HDL) particle size subclasses. Rabbits fed a cholesterol-enriched diet have been found to accumulate potentially atherogenic chylomicron remnants and beta-very low density lipoprotein (beta-VLDL) and show a rapid increase in liver and postheparin plasma hepatic lipase activity. To determine whether the particles that accumulate during cholesterol feeding are a stimulus for this increase in hepatic lipase activity, we infused normal chow-fed rabbits with a chylomicron remnant plus beta-VLDL-enriched plasma fraction isolated from rabbits fed 0.5% cholesterol-supplemented chow. The infusion of this plasma fraction for 4 h increased hepatic lipase activity up to 2.9-fold over control rabbits and resulted in a loss of larger sized HDL particles consistent with the action of hepatic lipase. The increase in activity was significantly correlated with the concentration of infusate phospholipid, unesterified cholesterol, and esterified cholesterol, but not with the infusate triglyceride concentration. The change in the plasma cholesterol concentration of recipient rabbits, which reflects the degree of lipoprotein accumulation in these rabbits, was also significantly correlated with the change in hepatic lipase activity. However, a chylomicron remnant and beta-VLDL-depleted fraction of plasma from cholesterol-fed rabbits did not increase hepatic lipase activity. Furthermore, triglyceride presented as an artificial lipid emulsion (Intralipid) was not able to stimulate hepatic lipase activity, although triglyceride is a substrate for hepatic lipase.(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗

The regulation of hepatic lipase and cholesteryl ester transfer protein activity in the cholesterol fed rabbit.

Hepatic lipase (HL) and cholesteryl ester transfer protein (CETP) activities are both increased in the rabbit by cholesterol feeding. The in vivo regulation of HL and CETP were explored by examining changes in specific steady-state mRNA levels upon cholesterol feeding. On feeding rabbits cholesterol, HL activity increased 3-fold after 2 days and remained at 2.6-times the control value at 28 days. Specific rabbit HL mRNA levels were assessed by dot blot analysis of liver poly (A)+ RNA hybridized with the human HL cDNA. No significant changes in liver HL mRNA accompanied the increase in activity seen at days 2 and 7. At day 28 a modest rise of 46% was observed. A significant rise in CETP activity, evident 7 days after the commencement of cholesterol feeding, was maintained until day 28 when it was 2.4-times the control value. Using the human CETP cDNA as probe, rabbit liver CETP mRNA was also found to increase by day 7, rising to 3.7-times control by day 28. The strong temporal relationship between the rise in CETP activity and mRNA (r = 0.55, P = 0.02) suggests that the regulation of CETP may be primarily effected by the levels of specific mRNA. In contrast, the discordance between levels of lipase activity and mRNA suggests that post-transcriptional events may be more important in the regulation of HL in the cholesterol fed rabbit.

Animals↗

Ventricular dysfunction following direct-current shock atrioventricular junction ablation.

Catheter-induced His bundle ablation for refractory supraventricular arrhythmias is most commonly performed with direct-current shock energy of 200-300 joules. The high energy pulse delivered by direct-current shock produces a lesion in the atrioventricular node by fulguration, with the residual energy being dissipated as a pressure wave. The effect of direct-current shock His bundle ablation on global and regional ventricular function was assessed in 14 consecutive patients by radionuclide ventriculography performed before and after ablation and again three months later. All studies were performed with ventricular pacing at 110 bpm. Global left ventricular ejection fraction was found to be significantly reduced at the three month study (0.43 +/- 0.03 vs 0.50 +/- 0.03, pre ablation, p = 0.02). A significant reduction in wall-motion score was also seen in six of the seven patients who had normal wall motion in pacing rhythm prior to ablation. Deterioration was mainly seen at the left and right ventricular apices. The observed reduction in ventricular function that follows direct-current shock His bundle ablation may result from myocardial damage from electro-coagulation or from barotrauma and supports continued investigation into alternative, less traumatic energy sources for the procedure.

Adult↗

Rabbit hepatic lipase cDNA sequence: low activity is associated with low messenger RNA levels.

We have investigated a possible mechanism for the reported low activity of hepatic lipase (HL) in the rabbit by cloning and sequencing the cDNA for rabbit HL and using the clone to quantify mRNA levels. A 1.6 kb cDNA clone was sequenced and found to encode the mature protein of 477 amino acids and 20 amino acids of the hydrophobic leader peptide. A high degree of amino acid sequence identity was demonstrated with human (81%) and rat (79%) HL. The putative active site was well conserved, and mutations reported to reduce activity in HL or lipoprotein lipase were not present in the rabbit sequence. The activity and mRNA levels were compared with those of the rat, an animal possessing relatively high HL activity. In post-heparin plasma of the rat, HL activity was nine times greater than in that of the rabbit (24.9 +/- 1.6 units per ml plasma, n = 5 vs. 2.7 +/- 0.1, n = 5, P = 0.0001). Comparison of mRNA levels was made by dot blot analysis of liver poly (A+) RNA obtained from each species and probed with either rabbit or rat HL cDNA, labeled to the same specific radioactivity. Specific HL mRNA levels were found to be nine times greater in the rat than in the rabbit (8.90 +/- 0.11 units, n = 5 vs. 1.00 +/- 0.01, n = 5, P = 0.0001). Thus, low hepatic lipase activity in the rabbit is associated with low mRNA levels, suggesting that the observed species difference in activity is due to differences in the level of mRNA.

Amino Acid Sequence↗

Return of sexual functioning following penile replant surgery.

The penis, scrotum, and testicles of a 31-year-old man were cut off in a fight. Fourteen hours later the penis and one testicle were reattached, but the testicle later had to be removed. By 3 weeks normal urinary function returned but the penis was misshapen. The patient had suicidal intentions. His partner was sexually supportive but afraid to touch the penis. By 10 weeks penile swelling occurred in response to a movie with frank sexual content. By 12 weeks the penile swelling was sufficient for entry but the partner was acutely afraid that her vaginal contractions would tear the scars. The man was concerned because he experienced only mild sexual tensions. Physical examination reassured both, and they gained hope for recovery. At 16 weeks erections were still not full but active intercourse was attempted and he experienced seminal seepage and mild orgasmic sensations; she was relaxed enough to have orgasm. Testosterone was administered at regular intervals from the 19th week on, with immediate improvement of erection. By 32 weeks full erection, ejaculation, and orgasmic functions returned and the couple resumed their normal sexual practices.

Adult↗

Coronary angioplasty for chronic total occlusion reduces the need for subsequent coronary bypass surgery.

Coronary angioplasty was performed in 44 consecutive patients with total occlusion that lasted longer than 1 week. The primary success rate was 59%. Angiographic restudy in 25 of the 26 successful patients (96%) revealed restenosis in 17 patients (65%), which was asymptomatic in seven (44%). Significant correlates of restenosis were mean luminal stenosis at the conclusion of the procedure and symptom recurrence. Clinical follow-up at a mean of 31 +/- 12 months revealed that coronary artery bypass surgery was more frequent in patients who had an unsuccessful initial angioplasty procedure (7/18 vs 3/26; p = 0.04). Nine patients (35%) who had an initially successful procedure required a second angioplasty for symptomatic restenosis. Angioplasty for totally occluded coronary arteries has a high incidence of restenosis that is often asymptomatic. This procedure can, however, lead to a reduction in the need for coronary artery bypass surgery for symptom control.

Angiography↗

Early and late results of balloon valvuloplasty for severe aortic stenosis.

Balloon aortic valvuloplasty has been used as treatment for selected patients with severe aortic stenosis. We report our experience of 11 procedures, performed on ten patients between October 1987 and June 1988. The peak aortic systolic gradient was reduced by 53% from 77 +/- 22 to 37 +/- 14 mmHg (p less than 0.0001) whilst cardiac output did not change significantly (4.1 +/- 1.7 to 3.8 +/- 1.6 (p less than 0.0001) whilst cardiac output did not change significantly (4.1 +/- 1.7 to 3.8 +/- 1.6 L/min). Aortic valve area was increased by 50%, from 0.4 +/- 0.2 to 0.6 +/- 0.2 cm2 (p less than 0.0001). Initial symptomatic improvement was achieved in eight patients. Echocardiographically demonstrated aortic regurgitation did not increase after valvuloplasty. There were no deaths during the procedure, no embolic events and no femoral artery complications. The mean follow-up for survivors was 9 +/- 3 months. Five patients died and three had symptom recurrence at an average of 13 weeks (six-24 weeks). Only two patients reported a continued improvement in symptoms. Balloon aortic valvuloplasty produced a small increase in aortic valve area and a satisfactory initial clinical response, but there was a high incidence of symptom recurrence. The procedure may have a role in the short-term palliation of severely symptomatic patients who are unable to have aortic valve replacement.

Acute Disease↗