Fragile sites-cytogenetic similarity with molecular diversity.
Explore the source record for details and available documents.
Animals↗
Biomedical subjects
R I Richards
Publications and source records attributed to R I Richards.
Fragile sites still breaking.
Rare fragile sites on chromosomes are the archetypal dynamic mutations. They involve large expansions of the microsatellite CCG or AT-rich minisatellites. The mutation process is an increase in repeat-unit number from within a normal range, through a premutation range, up to full mutation where the fragile site is expressed. Full mutations can inactivate genes and are regions of genomic instability. Common fragile sites, in particular, might have a role in oncogensis by facilitating gene inactivation through chromosomal deletion or amplification, but this requires further exploration. The mechanisms behind the changes that give rise to the cytogenetic manifestation of chromosomal fragility are now beginning to be understood.
Chromosome Fragile Sites↗
FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis.
A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich approximately 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded approximately 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.
Alleles↗
CAG repeat expansion in autosomal dominant familial spastic paraparesis: novel expansion in a subset of patients.
Autosomal dominant familial spastic paraplegia (FSP) is a genetically heterogeneous neurodegenerative disorder displaying anticipation for which three loci have been mapped to the chromosomal positions 14q11.2-q24.3 (SPG3), 2p21-p24 (SPG4) and 15q11.1 (SPG6). The repeat expansion detection (RED) method has been used to demonstrate expanded CAG repeats in some FSP families that map to SPG4. We analyzed 20 FSP families, including four for which there is evidence for linkage to SPG4, and found that in most cases the repeat expansion detected by RED is due to non-pathogenic expansions of the chromosome 18q21.1 SEF2-1 or 17q21.3 ERDA1 locus. Polymorphic expansions at SEF2-1 and ERDA1 appear frequent and may confound RED studies in the search for genes causing disorders demonstrating anticipation. In six FSP families, however, CAG repeat expansion was detected in a subset of affected and at-risk individuals that did not result from expansion of the SEF2-1 and ERDA1 loci. Overall, 11 of 37 (30%) of the FSP patients with a CAG/CTG repeat expansion are unaccounted for by the SEF2-1 and ERDA1 loci, compared with two of 23 (9%) of the unaffected at-risk individuals and none of 19 controls. In the majority of cases these novel expansions were shorter than those previously reported.
Basic Helix-Loop-Helix Leucine Zipper Transcriptio↗
Construction of an approximately 700-kb transcript map around the familial Mediterranean fever locus on human chromosome 16p13.3.
We used a combination of cDNA selection, exon amplification, and computational prediction from genomic sequence to isolate transcribed sequences from genomic DNA surrounding the familial Mediterranean fever (FMF) locus. Eighty-seven kb of genomic DNA around D16S3370, a marker showing a high degree of linkage disequilibrium with FMF, was sequenced to completion, and the sequence annotated. A transcript map reflecting the minimal number of genes encoded within the approximately 700 kb of genomic DNA surrounding the FMF locus was assembled. This map consists of 27 genes with discreet messages detectable on Northerns, in addition to three olfactory-receptor genes, a cluster of 18 tRNA genes, and two putative transcriptional units that have typical intron-exon splice junctions yet do not detect messages on Northerns. Four of the transcripts are identical to genes described previously, seven have been independently identified by the French FMF Consortium, and the others are novel. Six related zinc-finger genes, a cluster of tRNAs, and three olfactory receptors account for the majority of transcribed sequences isolated from a 315-kb FMF central region (between D16S468/D16S3070 and cosmid 377A12). Interspersed among them are several genes that may be important in inflammation. This transcript map not only has permitted the identification of the FMF gene (MEFV), but also has provided us an opportunity to probe the structural and functional features of this region of chromosome 16.
Amino Acid Sequence↗
Chromosomal localization of the human P2y6 purinoceptor gene and phylogenetic analysis of the P2y purinoceptor family.
The G-protein-coupled P2Y purinoceptors mediate a variety of physiological effects in response to extracellular nucleotides. With the recent discovery of several new members from a variety of species, the P2Y purinoceptor family now encompasses types P2Y1 to P2Y6. By fluorescence in situ hybridization and utilization of the National Center for Biotechnology Information (NCBI) database, the human P2Y6 gene was localized to chromosome 11q13.5, between polymorphic markers D11S1314 and D11S916. NCBI database analysis of the remaining human P2Y purinoceptor genes revealed that P2Y2 and P2Y6 mapped to within less than 4 cM, and thus constitute the first described chromosomal clustering of this gene family. Phylogenetic analysis of the P2Y purinoceptor family demonstrated the presence of five evolutionary branches and suggests the occurrence of an ancient gene duplication event.
Chromosome Mapping↗
Unbalanced t(4;11)(q32;q23) in a 34-year-old man with manifestations of distal monosomy 11q and trisomy 4q syndromes.
We present a 34-year-old man with an unbalanced translocation between the long arms of chromosome 4 and chromosome 11. He had manifestations of monosomy 11(q23)--minor facial anomalies, abnormal head shape, cryptorchidism; trisomy 4(q32)--hirsutism, renal disease; and manifestations attributable to both imbalances--heart disease, musculoskeletal anomalies, and mental retardation. FISH studies showed that the chromosome 11q23.3 translocation breakpoint was distal to the rare folate sensitive fragile site (FRA11B). The patient is the oldest reported with both imbalance of 4q+ and 11q-.
Adult↗
Construction of a 1-Mb restriction-mapped cosmid contig containing the candidate region for the familial Mediterranean fever locus (MEFV) on chromosome 16p 13.3.
In this paper we describe the assembly and restriction map of a 1.05-Mb cosmid contig spanning the candidate region for familial Mediterranean fever (FMF), a recessively inherited disorder of inflammation localized to 16p13.3. Using a combination of cosmid walking and screening for P1, PAC, BAC, and YAC clones, we have generated a contig of genomic clones spanning approximately 1050 kb that contains the FMF critical region. The map consists of 179 cosmid, 15 P1, 10 PAC, 3 BAC, and 17 YAC clones, anchored by 27 STS markers. Eight additional STSs have been developed from the approximately 700 kb immediately centromeric to this genomic region. Five of the 35 STSs are microsatellites that have not been previously reported. NotI and EcoRI mapping of the overlapping cosmids, hybridization of restriction fragments from cosmids to one another, and STS analyses have been used to validate the assembly of the contig. Our contig totally subsumes the 250-kb interval recently reported, by founder haplotype analysis, to contain the FMF gene. Thus, our high-resolution clone map provides an ideal resource for transcriptional mapping toward the eventual identification of this disease gene.
Base Sequence↗
Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat.
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Base Composition↗
Marfan Database (second edition): software and database for the analysis of mutations in the human FBN1 gene.
Fibrillin is the major component of extracellular microfibrils. Mutations in the fibrillin gene on chromosome 15 (FBN1) were described at first in the heritable connective tissue disorder, Marfan syndrome (MFS). More recently, FBN1 has also been shown to harbor mutations related to a spectrum of conditions phenotypically related to MFS. These mutations are private, essentially missense, generally non-recurrent and widely distributed throughout the gene. To date no clear genotype/phenotype relationship has been observed excepted for the localization of neonatal mutations in a cluster between exons 24 and 32. The second version of the computerized Marfan database contains 89 entries. The software has been modified to accomodate new functions and routines.
Animals↗
Dynamic mutation: possible mechanisms and significance in human disease.
Increases in repeat-DNA copy number are the molecular basis of a growing list of human genetic diseases, including fragile X syndrome, myotonic dystrophy, Huntington disease and a form of epilepsy. Repeat-DNA sequences undergo a unique process of dynamic mutation, the common properties of which probably reflect common molecular events. This form of mutation is no longer restricted to trinucleotide repeats, because repeats of different length have been found to undergo expansion.
Genetic Diseases, Inborn↗
Genetic heterogeneity in familial acute myelogenous leukemia: evidence for a second locus at chromosome 16q21-23.2.
The identification of genes responsible for the rare cases of familial leukemia may afford insight into the mechanism underlying the more common sporadic occurrences. Here we test a single family with 11 relevant meioses transmitting autosomal dominant acute myelogenous leukemia (AML) and myelodysplasia for linkage to three potential candidate loci. In a different family with inherited AML, linkage to chromosome 21q22.1-22.2 was recently reported; we exclude linkage to 21q22.1-22.2, demonstrating that familial AML is a heterogeneous disease. After reviewing familial leukemia and observing anticipation in the form of a declining age of onset with each generation, we had proposed 9p21-22 and 16q22 as additional candidate loci. Whereas linkage to 9p21-22 can be excluded, the finding of a maximum two-point LOD score of 2.82 with the microsatellite marker D16S522 at a recombination fraction theta = 0 provides evidence supporting linkage to 16q22. Haplotype analysis reveals a 23.5-cM (17.9-Mb) commonly inherited region among all affected family members extending from D16S451 to D16S289. In order to extract maximum linkage information with missing individuals, incomplete informativeness with individual markers in this interval, and possible deviance from strict autosomal dominant inheritance, we performed nonparametric linkage analysis (NPL) and found a maximum NPL statistic corresponding to a P-value of .00098, close to the maximum conditional probability of linkage expected for a pedigree with this structure. Mutational analysis in this region specifically excludes expansion of the AT-rich minisatellite repeat FRA16B fragile site and the CAG trinucleotide repeat in the E2F-4 transcription factor. The "repeat expansion detection" method, capable of detecting dynamic mutation associated with anticipation, more generally excludes large CAG repeat expansion as a cause of leukemia in this family.
Chromosome Mapping↗
Localisation of a 10q breakpoint within the PAX2 gene in a patient with a de novo t(10;13) translocation and optic nerve coloboma-renal disease.
We describe a 5 year old boy with a de novo t(10;13) translocation and optic nerve coloboma-renal disease (ONCR). On the basis of GTG banding analysis of prometaphase chromosomes, the patient's karyotype was interpreted as either 46,XY,t(10;13)(q24.3;q12.3) or t(10;13) (q25.2;q14.1). Fluorescence in situ hybridisation (FISH) studies using a YAC clone containing the PAX2 gene and YAC clones adjoining FRA10B at 10q25.2 showed that the 10q breakpoint had occurred just within the PAX2 gene and was proximal to FRA10B. These FISH results suggest that the translocation causes a disruption of the PAX2 gene and leads to ONCR, in agreement with the recent reports of PAX2 mutations in two unrelated families with ONCR. Furthermore, we refined the regional mapping of the human PAX2 gene to the junction of bands 10q24.3 and 10q25.1.
Child, Preschool↗
Repeat offenders: simple repeat sequences and complex genetic problems.
Explore the source record for details and available documents.
DNA Replication↗
Unusual inheritance patterns due to dynamic mutation in fragile X syndrome.
Fragile X syndrome is the most common form of familial mental retardation and is one of the world's most common genetic diseases. The inheritance patterns of the disease have many unusual features. It is an X-linked disorder yet there are asymptomatic carrier males. The disease is expressed only when the gene is inherited from the mother. The risk of a carrier woman having a child with the syndrome depends upon her position in the pedigree (the Sherman paradox) and her own intellectual status. The discovery that the disease is due to dynamic mutation (which is a multistage process) that inactivates FMR1 has provided an explanation for the unusual inheritance patterns. The finding of linkage disequilibrium between the fragile X mutations and closely linked DNA markers (haplotype) has required a reinterpretation of this phenomenon for dynamic mutations. Only a small number of normal alleles at the fragile X locus have long stretches of perfect repeat (2% with more than 24 copies) and these form a reservoir of alleles that can increase in length into the premutation range. Dynamic mutation is, so far, an exclusively human phenomenon, but this is probably because it has yet to be discovered in other species. Unusual inheritance patterns are a hallmark of dynamic mutation diseases.
Alleles↗
Dynamic mutation loci: allele distributions in different populations.
To assess the relative contributions of trans-acting factors (replication and repair functions) and cis-acting elements (repeat and flanking DNA composition) to the mechanism of trinucleotide repeat sequence mutation we have analysed the distribution of copy number polymorphisms at 12 loci associated with dynamic mutations in 15 populations of different ethnic origins. Genome wide instability of repeats in a particular population would be evidence of trans-acting factor instigation of the mutation process, whereas instability at a particular locus (perhaps even in several populations) would be evidence that the composition of the particular locus was the most significant factor contributing to mutation. The FRA16A locus is highly polymorphic in only the European population. Some other loci exhibit distinct distributions of alleles between different populations. Therefore sequences in the vicinity of the repeat -- the cis component of a particular locus -- appear(s) to be more important in the mutation mechanism than sporadic genome-wide instability induced by trans-acting factors such as the DNA mismatch repair enzymes.
Alleles↗
Linkage disequilibrium mapping places the gene causing familial Mediterranean fever close to D16S246.
This report presents refined genetic mapping data for the gene causing familial Mediterranean fever (FMF), a recessively inherited disorder of inflammation. We sampled 65 Jewish, Armenian, and Arab families and typed them for eight markers from chromosome 16p. Using a new algorithm that permits multipoint calculations for a dense map of markers in consanguineous families, we obtained a maximal LOD score of 49.2 at a location 1.6 cM centromeric to D16S246. A specific haplotype at D16S283-D16S94-D16S246 was found in 76% of Moroccan and 32% of non-Moroccan Jewish carrier chromosomes, but this haplotype was not overrepresented in Armenian or Arab FMF carriers. Moreover, the 2.5-kb allele at D16S246 was significantly associated with FMF in Moroccan and non-Moroccan Jews but not in Armenians or Arabs. Since the Moroccan Jewish community represents a relatively recently established and genetically isolated founder population, we analyzed the Moroccan linkage-disequilibrium data by using Luria-Delbrück formulas and simulations based on a Poisson branching process. These methods place the FMF susceptibility gene within 0.305 cM of D16S246 (2-LOD-unit range 0.02-0.64 cM).
Algorithms↗
Association of a chromosome deletion syndrome with a fragile site within the proto-oncogene CBL2.
The fragile site FRA11B has been localized to the p(CCG)n repeat of the CBL2 proto-oncogene. A proportion of Jacobsen (11q-) syndrome patients inherited a chromosome carrying a CBL2 p(CCG)n expansion, which was truncated close to FRA11B. These results have broad implications for the role of p(CCG)n repeat expansion in the aetiology of genetic disease involving chromosome rearrangements.
Base Sequence↗