Search PubMed⌕ Search

Biomedical subjects

R Frank

Publications and source records attributed to R Frank.

At least 397 records · Page 22Linked to original sources
PubMed1987

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.

Animals↗
PubMed1987

Inducible expression vectors incorporating the Escherichia coli atpE translational initiation region.

New expression vectors were constructed for use in strains of Escherichia coli. Their most important feature is a polylinker system that facilitates the insertion of a gene in an optimal relationship to the highly efficient E. coli atpE translational initiation region (from nucleotide -50 to the start codon). Three ATG-containing restriction endonuclease sites can be used for the insertion of the 5' end of a gene at, or near to, its translational initiation codon. These sites may alternatively be used for the creation of a suitable translational start codon. Transcription is started by the bacteriophage lambda major promoters pR and pL in tandem and terminated by the bacteriophage fd terminator. Transcriptional initiation is very effectively repressed at 28-30 degrees C by the product of the bacteriophage lambda cIts857 gene, which is also present on the vectors. Full induction is achieved by shifting the incubation temperature to 42 degrees C. The combination of highly efficient transcriptional and translational signals on these vectors allowed high-level expression of sequences encoding human interferon beta and interleukin 2 and of the E. coli atpA, sucC and sucD genes.

DNA Restriction Enzymes↗
PubMed1987

Membrane glycoproteins involved in neurite fasciculation.

Lectin affinity chromatography combined with mAb production was used to identify chick neural cell surface molecules related to L1 antigen, a mouse neural glycoprotein implicated in cell-cell adhesion (Rathjen, F. G., and M. Schachner, 1984, EMBO (Eur. Mol. Biol. Organ.) J., 3:1-10). A glycoprotein, G4 antigen, isolated by mAb G4 from adult chick brain is described which comprises a major 135-kD component, a minor doublet at 190 kD, and diffusely migrating bands at 80 and 65 kD in SDS PAGE. This molecule is structurally related to mouse L1 antigen according to NH2-terminal amino acid sequence (50% identity) as well as the behavior of its components in two-dimensional IEF/SDS PAGE gels. A second chicken glycoprotein, F11 antigen, was isolated from adult chick brain using mAb F11. This protein has also a major 135-kD component and minor components at 170 kD and 120 kD. Both immunotransfer analysis with polyclonal antibodies to mAb G4 and to mAb F11 isolate and the behavior on IEF/SDS PAGE gels indicates that the major 135-kD component of F11 antigen is distinct from G4 antigen components. However, the 135-kD component of F11 antigen shares with G4 antigen and the neural cell adhesion molecule (NCAM) the HNK-1/L2 carbohydrate epitope. In immunofluorescence studies, G4 and F11 antigenic sites were found to be associated mainly with the surface of process-bearing cells, particularly in fiber-rich regions of embryonic brain. Although Fab fragments of polyclonal antibodies to mAbs G4 or F11 immunoaffinity isolate only weakly inhibit the Ca2+-independent aggregation of neural cells, they strongly inhibit fasciculation of retinal axons. Together these studies extend the evidence that bundling of axons reflects the combined effects of a group of distinct cell surface glycoproteins.

Amino Acid Sequence↗
PubMed1987

An antibody specific for an endoproteolytic cleavage site provides evidence that pro-opiomelanocortin is packaged into secretory granules in AtT20 cells before its cleavage.

We have raised a rabbit antiserum against a synthetic peptide corresponding to the cleavage site between beta-lipotropic hormone and the ACTH moieties of murine pro-opiomelanocortin (POMC). After affinity purification, the anti-cleavage site antibody immunoprecipitates POMC from extracts of AtT20 cells but it does not immunoprecipitate the ACTH in such extracts or any of the other products of cleavage of POMC. By contrast, an antiserum raised against pure swine ACTH immunoprecipitates both POMC and ACTH from AtT20 cell extracts. Using the anti-cleavage site antibody we have shown that all the POMC synthesized during a 15-min pulse-labeling with [35S]methionine is cleaved at this site within 1 h. By immunoelectron microscopy we show that approximately 25-30% of peripheral secretory granules in AtT20 cells can be labeled with the anti-cleavage site antibody while anti-ACTH antiserum labels all these granules. This establishes that at least some POMC is packaged into secretory granules before its proteolytic cleavage.

Adrenocorticotropic Hormone↗
PubMed1987

Treatment of resistant ventricular tachycardia by endocavitary fulguration associated with anti-arrhythmic therapy.

Endocavitary fulgurations were practised in 26 cases of high risk ventricular tachycardia (VT) for which antiarrhythmics including amiodarone and class I antiarrhythmic agents given alone or in combination proved ineffectiveness. Permanent VT was present in nine patients at the time of the fulguration session: three were moribund, and two were unconscious. Included in the series were 10 cases of arrhythmogenic right ventricular dysplasia, nine patients had chronic VT several months after myocardial infarction, four had a non obstructive cardiomyopathy, two were idiopathic and one came after repair of the right ventricular outflow tract. Fulguration succeeded in preventing VT in the 22 patients who survived the initial period of treatment in association with therapeutic antiarrhythmics, in eight cases. Three of the four early deaths were probably related to imperfections in the technique. Two late deaths were due to spontaneous evolution of the disease. The follow-up period ranges from a minimum of 15 to a maximum of 34 months, with an average follow-up of nearly two years. The success rate of fulguration alone or for patients receiving prophylactic antiarrhythmic drugs is 90%. Ten patients required two sessions or more before VT was brought under control.

Adolescent↗
PubMed1987

Chemical-enzymatic synthesis, cloning and expression of a synthetic gene coding for an env protein fragment of the human T-cell leukemia virus type 1.

A synthetic gene for a 88 amino acid long env protein fragment of the human T-cell leukemia virus type 1 (HTLV1) has been assembled by ligation of 35 oligodesoxyribonucleotides, which were chemically synthesized by the phosphotriester segmental support method. After cloning into the pEX vector this HTLV1 env-protein fragment was expressed in E. coli.

Cloning, Molecular↗
PubMed1987

[Efficacy criteria in the fulguration of the bundle of His].

The authors have endeavoured to determine which of the parameters commonly used for His bundle ablation are likely to predict that ablation will be effective in altering the atrioventricular (AV) conduction system durability. His bundle ablation was performed in 18 patients (9 men, 9 women; mean age 47 years) presenting with supraventricular tachycardia refractory to all medical treatments. A total of 29 shocks were delivered with an Odam fulgurator, using a distal electrode connected to the positive pole of a selected catheter. Fifteen shocks were effective, resulting in a complete and permanent AV block (group I); the remaining 14 shocks failed to modify permanently the AV conduction system (group II). The parameters which differed between these two groups were the amplitude and the stability of the His bundle potential, the energy per kg bodyweight delivered with the shock and the possibility to shock the potential with the greatest amplitude in case of instability. A discriminant linear analysis showed that 3 interrelated criteria could be used to classify 83% of the shocks into one or the other group. In order of importance these criteria were: (1) amplitude of the His bundle potential; (2)energy delivered per kg bodyweight, and (3) stability of the potential. The corresponding discriminant values for successful results were more than 300 mV for parameter 1, more than 3 J/kg bodyweight for parameter 2 and very good stability of His bundle potential.

Adult↗
PubMed1986

[Endocavitary fulguration in the treatment of ventricular tachycardia complicating myocardial infarction].

Endocardial catheter fulguration of ventricular tachycardia consists of sending a defibrillating shock to the tip of an endocavitary catheter lying near the site of origin of the tachycardia. The shock may modify the arrhythmogenic substrate and prevent relapses. We have used this method in 9 cases of post-infarction chronic ventricular tachycardia resistant to drug therapy, and the patients were be followed up for more than 2 years. The results were sometimes life-saving, even in cases with badly damaged myocardium. The electric shock did not significantly alter the myocardium but modified the arrythmogenic substrate enough to prevent long-term relapses. When insufficiently effective, endocardial catheter fulguration can be repeated without problems. Used alone or combined with antiarrhythmic drugs, it opens prospects of new radical therapeutic approaches.

Adult↗
PubMed1986

Conformational analysis of hairpin oligodeoxyribonucleotides by a single-strand-specific nuclease.

Hairpin-forming oligodeoxynucleotides d[ATCCTA(A)NTAGGAT] with n = 3-6 were subjected to nuclease digestion with the nuclease from mung bean. Cleavage occurs only in the loop region of the hairpin molecules. In detail, the number and intensity of cleavage sites were determined in relation to the length of the loop, the temperature and the salt concentration. The restricted accessibility of mung bean nuclease to the loop bases adjacent to the helical region of all hairpins is due to a reduced exposure of these bases in presence of a certain Mg2+ concentration. With increasing temperature the exposure of these bases is increased. It is deduced that the bases adjacent to the helix increase the length of the latter by stacking, the degree of which is dependent on the number of loop bases.

Binding Sites↗
PubMed1986

Structural relationships in the adenylate kinase family.

The sequences of five distantly related adenylate kinases have been aligned. The local conservation of amino acids is discussed in the light of the known three-dimensional structure of one of the enzymes, the cytosolic isoenzyme 1 (AK1) from porcine muscle. The similarity profile outlines clearly the active site in the cleft of the spatial structure of AK1. The alignment reveals further that the enzyme family can be subdivided into small and large variants according to the presence or absence of a particular segment of about 30 residues in the middle of the chain. The extra segments of the large variants are strongly conserved.

Adenylate Kinase↗
PubMed1986

Efficient construction of cDNA libraries in plasmid expression vectors using an adaptor strategy.

We describe a method for the construction of large DNA fragment libraries in plasmid vectors, in which complementary, single-stranded extensions are ligated onto both vector and insert DNA using un-phosphorylated adaptor oligonucleotides. Special consideration has been taken of the requirements of expression screening as follows: cDNA synthesis using random oligonucleotide primers is described which maximises the probability of obtaining open reading frame fragments from large mRNA molecules, the adaptors use codons found in high abundance E. coli proteins to minimise problems of premature termination when using strong promoters, and the sequence encoded by the adaptors, when cloned into the bacterial expression vector pEX1, promotes a surface location for the foreign antigenic determinant where it is accessible to antibodies used for screening.

Bacterial Proteins↗