Biomedical subjects
Publications and source records attributed to R D Wells.
The etiology of fragile X syndrome, myotonic dystrophy and Kennedy's disease has been attributed to the massive expansion of triplet repeat DNA sequences. This review details the relationships between the structural diversity of DNA, its secondary structure or DNA-directed mutagenesis, and the expansion of triplet repeats.
In order to better define risk factors for perinatal substance abuse, data from 352 pregnant teenagers enrolled in a comprehensive prenatal clinic were analyzed. Fifteen years was the average age, 82% were of minority descent, and all were receiving public assistance. At their first visit, a social worker obtained information on their home environment, family history, education, peer relationships, physical and mental health, and history of substance use. Following the interview, all teens were given a complete prenatal examination, including drug toxicology screening. The results indicate relatively low rates of substance use based on toxicology at the time of enrollment (3.6%). Self-reported rates of substance use prior to awareness of conception varied from 23% for tobacco to 17% for alcohol and marijuana; 7% of the subjects reported use of illicit substances after conception was confirmed. In addition, 80 of the 352 subjects acknowledged having been physically or sexually abused and 40 admitted to having suicidal ideation or actions. A comparison of those teenagers who had been physically or sexually abused with the remaining cohort revealed significant differences on marijuana (p less than 0.01) and cocaine (p less than 0.05) use prior to awareness of conception and on prior suicidality (p less than 0.0001). A positive history of physical or sexual abuse delineated a subset of pregnant teenagers who were at high risk for self-destructive behaviors. Teenagers in prenatal clinics should be screened, not only for current and past substance use, but also for sexual and physical abuse, domestic violence, and suicidal thoughts and actions.
The pseudo EcoRI site GAATTA in the U3 region of the long terminal repeat of human immunodeficiency virus, which is flanked by a 26-base pair oligopurine tract, is readily nicked by either EcoRI or RsrI. The strand-specific nick occurs predominantly between the G and A residues and is independent of negative supercoiling. Other GAATTA sites surrounded by random (non-oligopurine) sequences are not nicked by these restriction endonucleases. However, other types and lengths of oligopurine tracts are effective in inducing the nicking in neighboring GAATTA sites. Hence, we propose that the flanking oligopurine tracts induce an altered DNA conformation on the GAATTA target site which may be similar to the transition state induced by EcoRI when binding to its canonical recognition site. Gel retardation analyses on restriction fragments containing the oligopurine-GAATTA-oligopurine sequences suggest the presence of helical axis distortions which are consistent with this interpretation.
Nuclear extracts from several tissue culture cell lines (human, primate, and murine) contain an endonuclease that specifically cleaves sequences at the herpes simplex virus 1 (HSV-1) segment inversion site. Mapping studies identified the preferential site of cleavage as a set of tandemly repeated dodecamers, the DR2 repeats. Endonuclease levels vary according to the proliferative state of the cell; little or no activity is detectable in extracts from quiescent cells, whereas high levels are expressed in dividing cells. Also, infection of density-arrested BSC-1 cells with HSV-1 induces a substantial increase (at least 35-fold) in endonucleolytic activity, which is first detectable at about 1 hr after infection at 32 degrees C. The elevated levels of enzyme activity then persist throughout the viral life cycle. In addition to the HSV-1 DR2 repeats, certain other G+C-rich sequences with an asymmetric distribution of purines and pyrimidines on the DNA strands and with appropriate sequences and lengths are substrates for the nuclease. These data indicate that target site recognition by the enzyme is conformation specific rather than sequence specific.
The influence of topoisomerase I and gyrase mutations in Escherichia coli on the supercoiled density of recombinant plasmids and the stability of left-handed Z-DNA was investigated. The formation of Z-DNA in vivo by dC-dG sequences of different lengths was used to determine the effective plasmid supercoil densities in the mutant strains. The presence of Z-DNA in the cells was detected by linking number and EcoRI methylase inhibition assays. A change in the unrestrained superhelical tension in vivo directly effects the B- to Z-DNA transition. Alterations in the internal or external environment of the cells, such as the inactivation of gyrase or topoisomerase I, a gyrase temperature-sensitive mutant, or starvation of cells, have a dramatic influence on the topology of plasmids. Also, E. coli has significantly more superhelical strain than Klebsiella, Morganella, or Enterobacter. These studies indicate that linking deficiency and effective supercoil density are mutually independent variables of plasmid tertiary structure. A variety of factors, such as protein-DNA interactions, activity of topoisomerases, and the resulting supercoil density, contribute to the B to Z transition inside living cells.
The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the DHFR replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.
The effect of neighboring AT-rich sequences on the right-handed B to left-handed Z transition was investigated in plasmids. The supercoil stabilized Z-DNA structure in (CG) tracts 36 and 40 base pairs (bp) in length revealed an unexpected conformational aberration at defined C residues proximal to one end (colL) when the inserts were bilaterally flanked by an 80% AT-rich segment (90 bp on one side and 331 bp on the other). The presence of the perturbed Z-conformation required (CG) stretches longer than 32 bp and bilateral flanking by the AT-rich tracts, since plasmids with the (CG) tracts unilaterally flanked had an orthodox Z-structure. The thermodynamics of the negative super-coil-induced transitions were influenced only slightly by the neighboring AT-rich regions. Hence, the nature of Z-conformations in plasmids is markedly influenced by intrinsic structural features of the (Pur-Pyr) tract and by seemingly modest changes in the properties of neighboring sequences over a distance of several helical turns.
The conformations adopted by five oligopurine.oligopyrimidine (pur.pyr) inserts of various lengths and sequence repeats in recombinant plasmids were evaluated as a function of pH and negative super-helicaldensity. Patterns of chemical reactivity (OsO4 and diethylpyrocarbonate) indicate that long (greater than 36 base pairs) pur.pyr segments can adopt intramolecular triplexes and that increasing the length of the pur.pyr tract reduces the dependence on low pH for structure formation, such that (GA)37 adopts an intramolecular triplex under moderate levels of negative superhelical stress (-sigma = 0.049) at neutral pH. This demonstrates that long pur.pyr segments, which are abundant in eukaryotic genomes, have the potential to adopt triplexes in vivo. Two-dimensional gel electrophoresis of the plasmids combined with chemical probing indicates that for longer sequences, multiple conformers of the intramolecular triplex exist at low pH. These conformers result from nucleation at various positions on the polypurine stretch, giving rise to different extents of relaxation at the same linking number. In addition, the metal ions Co2+, Mn2+, and Mg2+ have profound effects on the pattern of chemical reactivity displayed by long pur.pyr segments at both neutral and low pH, indicating that quite different structures may form in the presence of divalent metal ions. Thus, the types and extent of unusual structures adopted by long pur.pyr segments are complex and heterogeneous, and are dependent on pH, supercoiling, and the presence of divalent cations.
A polypurine.polypyrimidine (Pur.Pyr) sequence with a central interruption in a plasmid can adopt multiple non-B-DNA conformations depending on the conditions as revealed by specific chemical probes (OsO4, diethyl pyrocarbonate, and dimethyl sulfate) and two-dimensional electrophoresis. The relatively long mirror repeat Pur.Pyr sequences (GAA)9TTC(GAA)8 and (GGA)9TCC(GGA)8 form single canonical intramolecular triplexes at pH 7.0-6.0 in negatively supercoiled plasmids as isolated from Escherichia coli. With a lowering of the pH and/or an increase in the degree of negative supercoiling, these sequences undergo a novel conformational change as revealed by diethyl pyrocarbonate hypermodification of adenines in the middle of the polypurine strand and OsO4 reaction with thymines in the center and the quarter points of the polypyrimidine strand. To evaluate this structure, a family of related Pur.Pyr sequences were cloned and studied. The non mirror repeat sequence (GGA)9TCC(GAA)8 forms a non-B conformation only under acidic pH conditions, but the structural properties are different from those of the mirror repeat sequences. Furthermore, when the central interruptions of a mirror repeat sequence were increased from 3 to 9 bp, two canonical triplexes formed independently at pH 5.0 [at the (GAA)9 and (GAA)8 regions in the sequence (GAA)9TTAATTCGC(GAA)8]. Thus, if an interruption is sufficiently long, the two halves of the Pur.Pyr sequence do not interact with each other. Novel types of folded DNA geometries which explain these results are described.
An unequal sister chromatid exchange (USCE) in the mouse myeloma cell line MPC-11 between 3' regions of the C gamma 2a and C gamma 2b heavy chain genes results in duplication of the C gamma 2a heavy chain gene and generation of a novel recombination joint. The USCE occurs between (TC)n tracts adjacent to alternating purine-pyrimidine tracts. We have investigated the capacity of both the donor regions and the recombinant product involved in this event to adopt left-handed Z-DNA and intramolecular triplexes. The results of chemical probing with diethylpyrocarbonate and osmium tetroxide at the base pair level demonstrate that under the influence of negative supercoiling the alternating purine-pyrimidine regions of these plasmids can adopt Z-DNA at neutral pH, and the oligopurine.oligopyrimidine (pur.pyr) regions of these regions can adopt intramolecular triplexes at low pH (less than or equal to pH 6.0). At intermediate pH values, mixtures of both structures are present. Increasing the negative superhelical density of the plasmid does not increase the amount of triplex present at neutral pH indicating that the presence of long Z-DNA segments adjacent to pur.pyr tract prevents intramolecular triplex formation. In summary, we conclude that the sequences involved in the USCE can form either an intramolecular triplex in the (TC)n tract or Z-DNA in the alternating purine-pyrimidine tract and that Z-DNA will predominate under physiological conditions. The presence of segments which adopt Z-DNA at a site of USCE suggests that formation of this structure may enhance recombination between adjacent pur.pyr tracts.
The ability of oligopyrimidines to inhibit, through triple helix formation, the specific protein-DNA interactions of the EcoRI restriction and modification enzymes (EcoRI and MEcoRI) with their recognition sequence (GAATTC) was studied. The oligonucleotides (CTT)4 and (CTT)8 formed triplexes in plasmids at (GAA)n repeats containing EcoRI sites. Cleavage and methylation of EcoRI sites within these sequences were specifically inhibited by the oligonucleotides, whereas an EcoRI site adjacent to a (GAA)n sequence was inhibited much less. Also, other EcoRI sites within the plasmid, or in exogenously added lambda DNA, were not inhibited. These results demonstrate the potential of using triplex-forming oligonucleotides to block protein-DNA interactions at specific sites, and thus this technique may be useful in chromosome mapping and in the modulation of gene expression.
This study was designed to test two different methods for predicting pregnant teenagers at risk for failing to keep appointments for comprehensive prenatal care. Sixty-three pregnant adolescents completed psychological questionnaires assessing depression, social support, and life events. They and their primary health care provider also completed the Perinatal Health Belief Scales (PHBS) measuring the respondent's perception of risk and need for services. Following their infant's birth, adolescents completed a measure of health care satisfaction. Chart reviews provided data regarding birth weight, gestational age, Apgar scores, and appointment-keeping information. The results suggest that adolescents who failed to keep the most appointments were likely to have significantly lower levels of concern regarding their risks during pregnancy than their primary health care provider. Adolescents were more likely to keep appointments if they expressed levels of concern on the PHBS that were similar to their health care provider. The psychological measures and PHBS when applied individually, were not successful in predicting those with the greatest likelihood for nonadherence to appointments.
The influence of cytosine methylation on the supercoil-stabilized B-Z equilibrium in Escherichia coli was analyzed by two independent assays. Both the M.EcoRI inhibition assay and the linking-number assay have been used previously to establish that dC-dG segments of sufficient lengths can exist as left-handed helices in vivo. A series of dC-dG plasmid inserts with Z-form potential, ranging in length from 14 to 74 base pairs, was investigated. Complete methylation of cytosine at all HhaI sites, including the inserts, was obtained by coexpression of the HhaI methyltransferase (M.HhaI) in cells also carrying a dC-dG-containing plasmid. Both assays showed that for all lengths of dC-dG inserts, the relative amounts of B and Z helices were shifted to more Z-DNA in the presence of M.HhaI than in the absence of M.HhaI. These results indicate that cytosine methylation enhances the formation of Z-DNA helices at the superhelix density present in E. coli. The B-Z equilibrium, in combination with site-specific base methylation, may constitute a concerted mechanism for the modulation of DNA topology and DNA-protein interactions.
Salt-induced and supercoiling-induced B-Z junctions in pWR756, a plasmid containing (GC)16, were probed with bisulfite-methoxyamine, a modification reagent specific for single-stranded nucleic acids. The modification sites were analyzed with S1 nuclease and the modified cytosines were determined from termination sites of DNA chain elongation by DNA polymerase. The results showed that most accessible cytosines are the same for both types of B-Z junctions.
Biological processes such as transcription may generate domains of supercoiling on a circular DNA. The existence of these domains in Escherichia coli was investigated by the ability of different lengths of (CG) tracts, cloned upstream or downstream from the tetracycline resistance gene (tet) of pBR322, to adopt the Z structure in vivo. Segments as short as 12 base pairs adopt the Z form when cloned upstream from the tet gene (Eco RI site), whereas no Z DNA was detected when this sequence was cloned downstream (Sty I site), even with a 74-base pair (CG) tract that requires less supercoiling than shorter tracts for the B-Z transition. Hence the localized supercoil density in pBR322 can be as high as -0.038 and as low as -0.021 at different loci. These data demonstrate the existence of the Z structure for commonly found natural sequences and support the notion of domains of negative supercoiling in vivo.
The ability to clone a variety of sequences with varying capabilities of adopting non-B structures (left-handed Z-DNA, cruciforms or triplexes) into three loci of pBR322 was investigated. In general, the inserts were stable (non-deleted) in the EcoRI site (an untranslated region) of pBR322. However, sequences most likely to adopt left-handed Z-DNA or triplexes in vivo suffered deletions when cloned into the BamHI site, which is located in the tetracycline resistance structural gene (tet). Conversely, when the promoter for the tet gene was altered by filling-in the unique HindIII or ClaI sites, the inserts in the BamHI site were not deleted. Concomitantly, the negative linking differences of the plasmids were reduced. Also, inserts with a high potential to adopt Z-DNA conformations were substantially deleted in the PvuII site of pBR322 (near the replication origin and the copy number control region), but were less deleted if the tet promoter was insertion-mutated. The deletion phenomena are due to the capacity of these sequences to adopt left-handed Z-DNA or triplexes in vivo since shorter inserts, less prone to form non-B DNA structures, or random sequences, did not exhibit this behavior. Sequences with the potential to adopt cruciforms were stable in all sites under all conditions. These results reveal a complex interrelationship between insert deletions (apparently the result of genetic recombination), negative supercoiling, and the formation of non-B DNA structures in living Escherichia coli cells.
The segment inversion site of herpes simplex virus type 1 contains a series of tandem repeats with a purine bias on one strand and high G + C content (DR2 repeats) capable of adopting a non-B-DNA structure under a variety of conditions. Plasmids carrying eight contiguous copies of DR2 sequences undergo a series of supercoil-driven conformational transitions resulting in different extents of relaxation at pH 5.0. These transitions depend on the presence of an appropriate concentration of divalent cations (Mg2+ and Ca2+) which seem to interact specifically with the alternate structure(s). The transitions occurred at approximately the same superhelical density for all lengths of inserts studied. However, the onset of the transition can be shifted to lower negative superhelical densities by increasing NaCl concentrations. This leads to a reduction of the cooperativity of the transition, which takes place over a range of linking isomers under these conditions. Extrapolating from these results, we established physiological conditions where the alternate DNA structure is found at negative superhelical densities as low as -0.035. The existence of non-B-DNA conformations and/or the structural transitions of these sequences located in this region of intense biological activity implies their involvement in the life cycle of the virus.
The capacity of four oligopurine.oligopyrimidine (pur.pyr) sequences with different lengths of interruptions in the center [GAA)4(N)n(GAA)4G) (n = 3, 5, 7, and 9) to adopt intramolecular DNA triplexes was evaluated in recombinant plasmids. The hyperreactive patterns of the pur.pyr inserts to specific chemical probes (OsO4, diethyl pyrocarbonate, and dimethyl sulfate) at the base pair level demonstrate that intramolecular triplexes with identical 12-base triads in the stem but with different loop sizes (4, 6, 8, and 10 bases) can form in supercoiled plasmids. Furthermore, the extent of OsO4 modification was measured as a function of temperature and of average negative supercoil density. In addition, the transition free energy of B-DNA to triplexes at pH 4.5 was determined by two-dimensional electrophoresis. These comparative studies show that longer loops require more supercoil energy for triplex formation and are less thermostable than triplexes with shorter loops. Also, it may be that not only the loop size but the base composition of the loop region affects the structural transition and triplex stability. Thus, these results significantly broaden the range of natural pur.pyr sequences that may adopt triplexes.