Biomedical subjects

R D Wells

Publications and source records attributed to R D Wells.

At least 19 recordsLinked to original sources

PubMed1992

Central non-Pur.Pyr sequences in oligo(dG.dC) tracts and metal ions influence the formation of intramolecular DNA triplex isomers.

The effect of the central non-Pur.Pyr sequences in oligo(dG.dC) inserts on determining the type of intramolecular DNA triplex isomers formed in negatively supercoiled plasmids was investigated. Different triplex types (H-r3, H-r5, and H-y3), revealed by a combination of chemical probing and Maxam-Gilbert sequencing reactions, were adopted by the oligo(dG.dC) tracts depending on the length and composition of the central non-Pur.Pyr sequences (0, 3, or 5 base pairs) and the kind of metal ions. The H-r3 triplex conformer, one isomer of a Pur.Pur.Pyr structure, was formed in the (C)20 and (C)10GCG(C)10 inserts in plasmids in the presence of certain metal ions. Interestingly, H-r5, the other isomer of the Pur.Pur-Pyr triplex which had not been detected previously, was formed in a (C)9GAATT(C)9 insert in the presence of either Mg2+ or Ca2+. Alternatively, H-y3, one isomer of a Pyr.Pur.Pyr triplex, was formed in the (C)9GAATT(C)9 insert in the absence of metal ions. Thus, central non-Pur.Pyr sequences and metal ions play a role as determinants of the types of intramolecular triplexes formed; they also reduce the requirement of longer Pur.Pyr repeat sequences to form intramolecular triplexes. Furthermore, the effects of MgCl2 concentration and pH on the formation of triplex isomers were examined. The Pur.Pur.Pyr conformations (H-r3 and H-r5) may be the favored conformations in the cellular milieu, since they are stable at physiological pH and metal ion concentration.

Acetaldehyde↗

PubMed1992

GC-rich flanking tracts decrease the kinetics of intramolecular DNA triplex formation.

The effect of the base composition of flanking sequences on DNA intramolecular triplex formation was investigated in negatively supercoiled plasmids. The rates of triplex formation at two oligopurine.oligopyrimidine inserts with interrupting sequences in plasmids containing AT- or GC-rich flanking sequences were compared as a function of temperature, pH, and negative superhelical density. The kinetics of the transition of linear B-DNA to triplex (also called H-DNA) were influenced by all of these factors; triplexes were formed slower in a GC-rich background than in an AT-rich background. However, at equilibrium, the same amounts of the triplexes in AT- or GC-rich contexts were formed, and the conformations adopted by (GAA)4TTCGC(GAA)4 showed the canonical intramolecular triplex as mapped with chemical probes. We propose that the GC-rich segments caused this effect by thermodynamically clamping the DNA inserts, since the dependence of kinetics on base composition disappeared in tetraalkylammonium ions which eliminate the dependence of helix-coil transitions on base composition. The dependence of the kinetics of intramolecular triplex formation on flanking sequences further strengthens the concept of the role of DNA as a dynamic participant in cellular events.

Base Sequence↗

PubMed1992

Intermolecular triplex formation distorts the DNA duplex in the regulatory region of human papillomavirus type-11.

A conformational distortion in the DNA duplex at the regulatory region of human papillomavirus type-11 next to an intermolecular triplex, formed with a synthetic oligonucleotide, was investigated with several chemical probes. The sequence targeted for triplex formation borders on the binding sites for the regulatory proteins encoded by the viral E2 open reading frame. Dimethyl sulfate, diethyl pyrocarbonate, and OsO4 all react to a greater extent with nucleotides in the duplex that are immediately adjacent to the triplex as compared to other bases throughout the duplex. This hypermodification was observed on both the polypurine and polypyrimidine strands of the duplex DNA. Similar hyperreactivity of bases flanking a triplex also was seen when the contiguous target polypurine tract was effectively extended by mutating interrupting pyrimidines in the human papillomavirus type-11 sequence to purines. We propose that this hyperreactivity is due to a structural distortion caused by the junction between the triplex and the duplex tracts.

Base Sequence↗

PubMed1992

Nodule DNA in the (GA)37.(CT)37 insert in superhelical plasmids.

Di- or trivalent metal ions stabilize a supercoil-dependent transition in pGA37, which contains the (GA)37.(CT)37 insert, at neutral and basic pH. The structure formed is different from the well known protonated triplexes (H-DNA) adopted at low pH by polypurine.polypyrimidine (Pur.Pyr) inserts in plasmids. DNA samples must be preincubated in the presence of multivalent ions at 50 degrees C for the new transition to occur. At neutral pH in the presence of Co hexamine, both strands of the insert have modification maxima situated at one-third of the distance from both ends. We propose the formation of a new structure called nodule DNA which consists of both Pyr.Pur.Pyr and Pur.Pur.Pyr triplexes and does not contain continuous single-stranded regions. At basic pH (greater than 8.5) in the presence of magnesium ions, the modification pattern corresponds to Pur.Pur.Pyr triplex formation in the whole insert. At neutral pH in the presence of magnesium, both nodule DNA and the Pur.Pur.Pyr triplex can be formed in the insert. We also observed a magnesium-dependent transition at neutral pH in the other Pur.Pyr insert containing plasmids. These data demonstrate that Pur.Pyr sequences can adopt several non-B conformations at close to in vivo conditions.

Base Sequence↗

PubMed1992

Metal ions cause the isomerization of certain intramolecular triplexes.

The influence of cations on the capacity of five oligopurine.oligopyrimidine mirror repeat sequences to adopt intramolecular triplexes (the usual H-y3 isomer and/or the rare H-y5 isomer) in recombinant plasmids was investigated. Unexpectedly, the presence of certain metal ions (magnesium, zinc, manganese, and calcium) stabilized the (GAA)4TTCGC(GAA)4 insert in the rare H-y5 when cloned into either of two different sequence backgrounds. Alternatively, either shortening or lengthening the sequence at the central interruption, which becomes the loop of the triplex, led to the formation of the canonical H-y3 under all conditions tested. Similarly, other oligopurine.oligopyrimidine mirror repeat sequences (i.e. (GAA)8 or (GGA)8) formed only the H-y3 under all experimental conditions. All triplexes were stabilized by negative supercoiling at pH 5.0; chemical probe and primer extension analyses served as critical structural tools. Hence, the nature of the central interruption sequence (the loop) of the mirror repeat is important for the stabilization of the H-y5. This region may be important for metal ion binding in the initial stages of triplex formation and thus may play a critical role in determining which isomer is formed. The possible biological role of a DNA sequence adopting three different conformations is discussed.

Cations↗

PubMed1992

Direct evidence for the effect of transcription on local DNA supercoiling in vivo.

The B-to-Z structural transition of varying lengths (74 to 14 base-pairs) of (CG) tracts has been used as a superhelicity probe to examine the local topological changes induced by transcription at defined genetic loci in vivo. The local-topology reporter sequences indicate that under steady-state transcription the region upstream from the promoter experiences an increase in negative supercoiling whereas the region downstream from the terminator displays a decrease in negative superhelicity. This result provides direct in vivo evidence for the notion that the translocation of an RNA polymerase elongation complex along the double-helical DNA generates positive supercoils in front of it and negative supercoils behind it. Also, this twin-supercoiled domain model was tested inside a transcribed region where a high degree of negative supercoiling generated by the passage of each individual RNA polymerase was detected. Hence, these data indicate that the induced supercoils are confined to the vicinity of each RNA polymerase complex in a multipolymerase system.

Base Composition↗

PubMed1992

DNA structure, mutations, and human genetic disease.

The etiology of fragile X syndrome, myotonic dystrophy and Kennedy's disease has been attributed to the massive expansion of triplet repeat DNA sequences. This review details the relationships between the structural diversity of DNA, its secondary structure or DNA-directed mutagenesis, and the expansion of triplet repeats.

Base Sequence↗

PubMed1992

Physical and sexual abuse as predictors of substance use and suicide among pregnant teenagers.

In order to better define risk factors for perinatal substance abuse, data from 352 pregnant teenagers enrolled in a comprehensive prenatal clinic were analyzed. Fifteen years was the average age, 82% were of minority descent, and all were receiving public assistance. At their first visit, a social worker obtained information on their home environment, family history, education, peer relationships, physical and mental health, and history of substance use. Following the interview, all teens were given a complete prenatal examination, including drug toxicology screening. The results indicate relatively low rates of substance use based on toxicology at the time of enrollment (3.6%). Self-reported rates of substance use prior to awareness of conception varied from 23% for tobacco to 17% for alcohol and marijuana; 7% of the subjects reported use of illicit substances after conception was confirmed. In addition, 80 of the 352 subjects acknowledged having been physically or sexually abused and 40 admitted to having suicidal ideation or actions. A comparison of those teenagers who had been physically or sexually abused with the remaining cohort revealed significant differences on marijuana (p less than 0.01) and cocaine (p less than 0.05) use prior to awareness of conception and on prior suicidality (p less than 0.0001). A positive history of physical or sexual abuse delineated a subset of pregnant teenagers who were at high risk for self-destructive behaviors. Teenagers in prenatal clinics should be screened, not only for current and past substance use, but also for sexual and physical abuse, domestic violence, and suicidal thoughts and actions.

Adolescent↗

PubMed1991

A DNA conformational alteration induced by a neighboring oligopurine tract on GAATTA enables nicking by EcoRI.

The pseudo EcoRI site GAATTA in the U3 region of the long terminal repeat of human immunodeficiency virus, which is flanked by a 26-base pair oligopurine tract, is readily nicked by either EcoRI or RsrI. The strand-specific nick occurs predominantly between the G and A residues and is independent of negative supercoiling. Other GAATTA sites surrounded by random (non-oligopurine) sequences are not nicked by these restriction endonucleases. However, other types and lengths of oligopurine tracts are effective in inducing the nicking in neighboring GAATTA sites. Hence, we propose that the flanking oligopurine tracts induce an altered DNA conformation on the GAATTA target site which may be similar to the transition state induced by EcoRI when binding to its canonical recognition site. Gel retardation analyses on restriction fragments containing the oligopurine-GAATTA-oligopurine sequences suggest the presence of helical axis distortions which are consistent with this interpretation.

Base Sequence↗

PubMed1991

The herpes simplex virus 1 segment inversion site is specifically cleaved by a virus-induced nuclear endonuclease.

Nuclear extracts from several tissue culture cell lines (human, primate, and murine) contain an endonuclease that specifically cleaves sequences at the herpes simplex virus 1 (HSV-1) segment inversion site. Mapping studies identified the preferential site of cleavage as a set of tandemly repeated dodecamers, the DR2 repeats. Endonuclease levels vary according to the proliferative state of the cell; little or no activity is detectable in extracts from quiescent cells, whereas high levels are expressed in dividing cells. Also, infection of density-arrested BSC-1 cells with HSV-1 induces a substantial increase (at least 35-fold) in endonucleolytic activity, which is first detectable at about 1 hr after infection at 32 degrees C. The elevated levels of enzyme activity then persist throughout the viral life cycle. In addition to the HSV-1 DR2 repeats, certain other G+C-rich sequences with an asymmetric distribution of purines and pyrimidines on the DNA strands and with appropriate sequences and lengths are substrates for the nuclease. These data indicate that target site recognition by the enzyme is conformation specific rather than sequence specific.

Animals↗

PubMed1991

Topoisomerase mutants and physiological conditions control supercoiling and Z-DNA formation in vivo.

The influence of topoisomerase I and gyrase mutations in Escherichia coli on the supercoiled density of recombinant plasmids and the stability of left-handed Z-DNA was investigated. The formation of Z-DNA in vivo by dC-dG sequences of different lengths was used to determine the effective plasmid supercoil densities in the mutant strains. The presence of Z-DNA in the cells was detected by linking number and EcoRI methylase inhibition assays. A change in the unrestrained superhelical tension in vivo directly effects the B- to Z-DNA transition. Alterations in the internal or external environment of the cells, such as the inactivation of gyrase or topoisomerase I, a gyrase temperature-sensitive mutant, or starvation of cells, have a dramatic influence on the topology of plasmids. Also, E. coli has significantly more superhelical strain than Klebsiella, Morganella, or Enterobacter. These studies indicate that linking deficiency and effective supercoil density are mutually independent variables of plasmid tertiary structure. A variety of factors, such as protein-DNA interactions, activity of topoisomerases, and the resulting supercoil density, contribute to the B to Z transition inside living cells.

DNA Topoisomerases, Type I↗

PubMed1990

Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures.

The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the DHFR replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.

Animals↗

PubMed1990

Flanking AT-rich tracts cause a structural distortion in Z-DNA in plasmids.

The effect of neighboring AT-rich sequences on the right-handed B to left-handed Z transition was investigated in plasmids. The supercoil stabilized Z-DNA structure in (CG) tracts 36 and 40 base pairs (bp) in length revealed an unexpected conformational aberration at defined C residues proximal to one end (colL) when the inserts were bilaterally flanked by an 80% AT-rich segment (90 bp on one side and 331 bp on the other). The presence of the perturbed Z-conformation required (CG) stretches longer than 32 bp and bilateral flanking by the AT-rich tracts, since plasmids with the (CG) tracts unilaterally flanked had an orthodox Z-structure. The thermodynamics of the negative super-coil-induced transitions were influenced only slightly by the neighboring AT-rich regions. Hence, the nature of Z-conformations in plasmids is markedly influenced by intrinsic structural features of the (Pur-Pyr) tract and by seemingly modest changes in the properties of neighboring sequences over a distance of several helical turns.

Adenine↗

PubMed1990

Effect of length, supercoiling, and pH on intramolecular triplex formation. Multiple conformers at pur.pyr mirror repeats.

The conformations adopted by five oligopurine.oligopyrimidine (pur.pyr) inserts of various lengths and sequence repeats in recombinant plasmids were evaluated as a function of pH and negative super-helicaldensity. Patterns of chemical reactivity (OsO4 and diethylpyrocarbonate) indicate that long (greater than 36 base pairs) pur.pyr segments can adopt intramolecular triplexes and that increasing the length of the pur.pyr tract reduces the dependence on low pH for structure formation, such that (GA)37 adopts an intramolecular triplex under moderate levels of negative superhelical stress (-sigma = 0.049) at neutral pH. This demonstrates that long pur.pyr segments, which are abundant in eukaryotic genomes, have the potential to adopt triplexes in vivo. Two-dimensional gel electrophoresis of the plasmids combined with chemical probing indicates that for longer sequences, multiple conformers of the intramolecular triplex exist at low pH. These conformers result from nucleation at various positions on the polypurine stretch, giving rise to different extents of relaxation at the same linking number. In addition, the metal ions Co2+, Mn2+, and Mg2+ have profound effects on the pattern of chemical reactivity displayed by long pur.pyr segments at both neutral and low pH, indicating that quite different structures may form in the presence of divalent metal ions. Thus, the types and extent of unusual structures adopted by long pur.pyr segments are complex and heterogeneous, and are dependent on pH, supercoiling, and the presence of divalent cations.

Base Composition↗

PubMed1990

Multiple non-B-DNA conformations of polypurine.polypyrimidine sequences in plasmids.

A polypurine.polypyrimidine (Pur.Pyr) sequence with a central interruption in a plasmid can adopt multiple non-B-DNA conformations depending on the conditions as revealed by specific chemical probes (OsO4, diethyl pyrocarbonate, and dimethyl sulfate) and two-dimensional electrophoresis. The relatively long mirror repeat Pur.Pyr sequences (GAA)9TTC(GAA)8 and (GGA)9TCC(GGA)8 form single canonical intramolecular triplexes at pH 7.0-6.0 in negatively supercoiled plasmids as isolated from Escherichia coli. With a lowering of the pH and/or an increase in the degree of negative supercoiling, these sequences undergo a novel conformational change as revealed by diethyl pyrocarbonate hypermodification of adenines in the middle of the polypurine strand and OsO4 reaction with thymines in the center and the quarter points of the polypyrimidine strand. To evaluate this structure, a family of related Pur.Pyr sequences were cloned and studied. The non mirror repeat sequence (GGA)9TCC(GAA)8 forms a non-B conformation only under acidic pH conditions, but the structural properties are different from those of the mirror repeat sequences. Furthermore, when the central interruptions of a mirror repeat sequence were increased from 3 to 9 bp, two canonical triplexes formed independently at pH 5.0 [at the (GAA)9 and (GAA)8 regions in the sequence (GAA)9TTAATTCGC(GAA)8]. Thus, if an interruption is sufficiently long, the two halves of the Pur.Pyr sequence do not interact with each other. Novel types of folded DNA geometries which explain these results are described.

Base Sequence↗

PubMed1990

Left-handed Z-DNA and intramolecular triplex formation at the site of an unequal sister chromatid exchange.

An unequal sister chromatid exchange (USCE) in the mouse myeloma cell line MPC-11 between 3' regions of the C gamma 2a and C gamma 2b heavy chain genes results in duplication of the C gamma 2a heavy chain gene and generation of a novel recombination joint. The USCE occurs between (TC)n tracts adjacent to alternating purine-pyrimidine tracts. We have investigated the capacity of both the donor regions and the recombinant product involved in this event to adopt left-handed Z-DNA and intramolecular triplexes. The results of chemical probing with diethylpyrocarbonate and osmium tetroxide at the base pair level demonstrate that under the influence of negative supercoiling the alternating purine-pyrimidine regions of these plasmids can adopt Z-DNA at neutral pH, and the oligopurine.oligopyrimidine (pur.pyr) regions of these regions can adopt intramolecular triplexes at low pH (less than or equal to pH 6.0). At intermediate pH values, mixtures of both structures are present. Increasing the negative superhelical density of the plasmid does not increase the amount of triplex present at neutral pH indicating that the presence of long Z-DNA segments adjacent to pur.pyr tract prevents intramolecular triplex formation. In summary, we conclude that the sequences involved in the USCE can form either an intramolecular triplex in the (TC)n tract or Z-DNA in the alternating purine-pyrimidine tract and that Z-DNA will predominate under physiological conditions. The presence of segments which adopt Z-DNA at a site of USCE suggests that formation of this structure may enhance recombination between adjacent pur.pyr tracts.

Animals↗

PubMed1990

Site-specific inhibition of EcoRI restriction/modification enzymes by a DNA triple helix.

The ability of oligopyrimidines to inhibit, through triple helix formation, the specific protein-DNA interactions of the EcoRI restriction and modification enzymes (EcoRI and MEcoRI) with their recognition sequence (GAATTC) was studied. The oligonucleotides (CTT)4 and (CTT)8 formed triplexes in plasmids at (GAA)n repeats containing EcoRI sites. Cleavage and methylation of EcoRI sites within these sequences were specifically inhibited by the oligonucleotides, whereas an EcoRI site adjacent to a (GAA)n sequence was inhibited much less. Also, other EcoRI sites within the plasmid, or in exogenously added lambda DNA, were not inhibited. These results demonstrate the potential of using triplex-forming oligonucleotides to block protein-DNA interactions at specific sites, and thus this technique may be useful in chromosome mapping and in the modulation of gene expression.

DNA Modification Methylases↗

PubMed1990

Perinatal Health Belief Scales. A cost-effective technique for predicting prenatal appointment keeping rates among pregnant teenagers.

This study was designed to test two different methods for predicting pregnant teenagers at risk for failing to keep appointments for comprehensive prenatal care. Sixty-three pregnant adolescents completed psychological questionnaires assessing depression, social support, and life events. They and their primary health care provider also completed the Perinatal Health Belief Scales (PHBS) measuring the respondent's perception of risk and need for services. Following their infant's birth, adolescents completed a measure of health care satisfaction. Chart reviews provided data regarding birth weight, gestational age, Apgar scores, and appointment-keeping information. The results suggest that adolescents who failed to keep the most appointments were likely to have significantly lower levels of concern regarding their risks during pregnancy than their primary health care provider. Adolescents were more likely to keep appointments if they expressed levels of concern on the PHBS that were similar to their health care provider. The psychological measures and PHBS when applied individually, were not successful in predicting those with the greatest likelihood for nonadherence to appointments.

Adolescent↗