Search PubMed⌕ Search

Biomedical subjects

R Contreras

Publications and source records attributed to R Contreras.

At least 109 records · Page 6Linked to original sources
PubMed1979

Asymmetric linker molecules for recombinant DNA constructions.

Asymmetric EcoRI DNA linkers consisting of an AATTC(A)7 dodecamer and a complementary G(T)7 octamer were synthesized. Ligation of such linkers to DNA fragments obviates the need for EcoRI digestion prior to cloning in EcoRI-cleaved vectors.

Base Sequence↗
PubMed1979

Nucleotide sequence analysis of two simian virus 40 mutants with deletions in the late region of the genome.

Two mutants of simian virus 40, dl-1261 and dl-1262, have deletions that map between coordinated 0.90 and 0.95 (Cole et al., J. Virol 24:277--294, 1977). Both affect the structure of the two minor proteins VP2 and VP3. The precise location and size of the deletions have now been determined by nucleotide sequence analysis. Mutant dl-1261 is deleted of 54 base pairs, is temperature sensitive for the protein defined by the D complementation group, and promotes the synthesis of shorter VP2 and VP3 polypeptides. Mutant dl-1262 is viable irrespective of temperature and has a deletion of 36 base pairs, 23 of which overlap the deletion in dl-1261. Since these mutants produce normal VP1, the deleted regions probably have no function in the splicing of precursor RNA to the VP1 mRNA.

Base Sequence↗
PubMed1978

Nucleotide sequence of the restriction fragment Hind-F-EcoRI1 of simian-virus-40 DNA (part of the VP1 gene).

The nucleotide sequence of the simian virus 40 (SV40) genome region between the cleavage sites for restriction endonucleases EcoRI (map position 0) and HindII (map position 0.05) has been determined mainly by the partial chemical DNA degradation procedure of Maxam and Gilbert. This fragment represents 5.3% of the genome of SV40 and is located in the late region, internally in the VP1 gene. The message strand shows only one open reading frame for translation into protein, which connects to the one for the preceding fragment. On this basis part of the amino acid sequence of the VP1 protein is presented.

Base Sequence↗
PubMed1978

Complete nucleotide sequence of SV40 DNA.

The determination of the total 5,224 base-pair DNA sequence of the virus SV40 has enabled us to locate precisely the known genes on the genome. At least 15.2% of the genome is presumably not translated into polypeptides. Particular points of interest revealed by the complete sequence are the initiation of the early t and T antigens at the same position and the fact that the T antigen is coded by two non-contiguous regions of the genome; the T antigen mRNA is spliced in the coding region. In the late region the gene for the major protein VP1 overlaps those for proteins VP2 and VP3 over 122 nucleotides but is read in a different frame. The almost complete amino acid sequences of the two early proteins as well as those of the late proteins have been deduced from the nucleotide sequence. The mRNAs for the latter three proteins are presumably spliced out of a common primary RNA transcript. The use of degenerate codons is decidedly non-random, but is similar for the early and late regions. Codons of the type NUC, NCG and CGN are absent or very rare.

Antigens, Neoplasm↗
PubMed1977

Overlapping of the VP2-VP3 gene and the VP1 gene in the SV40 genome.

The nucleotide sequence of the SV40 Hind E fragment has been determined mainly by the partial chemical degradation procedure of Maxam and Gilbert (1977). The sequence of the strand with the same polarity as the late messenger RNA shows only one open reading frame for translation. Considering that VP3 corresponds to the carbosyl terminal part of VP2, and considering various evidence which indicates that the SV40 Hind E segment is part of the amino acid sequence of VP2-VP3. It continues clockwise in Hind K, where it terminates with a UAA signal. The latter is located 110 nucleotides beyond the initiation signal for the major structural protein VP1 (Fiers et al., 1975; Van de Voorde et al., 1976). Hence this small overlapping region of the genome codes for the synthesis of three different proteins in two different reading frames. The deduced amino acid sequence covers a major part of the vp3 poly peptide, and the amino acid composition is in good agreement with published values (Greenaway and Levine, 1973).

Base Sequence↗
PubMed1977

Nucleotide sequence of the restriction fragment Hind F-Eco RI2 of SV40 DNA.

The nucleotide sequence of the SV40 genome region between the Hind K fragment and the Eco RI cleavage site has been determined by a combination of three different approaches : analysis of RNA products obtained by transcription with Escherichia coli DNA dependent RNA polymerase, partial degradations with snake venom exonuclease and base-specific chemical degradation of 5'-terminal labeled restriction fragments. This nucleotide sequence shows only one open reading frame and allows the deduction of a small segment of the amino acid sequence of VP1, the major structural protein.

Alkaline Phosphatase↗
PubMed1976

Escherichia coli tyrosine transfer ribonucleic acid genes. Nucleotide sequences of their promoters and of the regions adjoining C-C-A ends.

The template-dependent primer elongation method for determining DNA sequences of specific regions (e.g. Loewen, P., Sekiaya, T., and Khorana, H. G. (1974) J. Biol. Chem. 249, 217-226) has been applied to the determination of the sequences of the promoters and of the regions beyond the C-C-A ends of the tyrosine tRNA genes in Escherichia coli. The following results have been obtained. (a) The promoter of the tRNA1Tyr (su+) gene in the bacteriophage phi80psu+III (the singlet strain) and phi80psu+-III (the doublet strain) and, significantly, the promoter of the tRNA2Tyr gene in the bacteriophage lambdah80dglyTsu+36 all have the following identical sequence in the first 59 nucleotides: (see article) Transcription begins at the underlined terminal nucleotide and proceeds to the right. (b) tRNA1Tyr (su+) as present in the singlet strain phi80psu+III and the tRNA1Tyr (su-), the second gene in the doublet strain phi80psu+-III, have the following identical sequence beyond the C-C-A sequences: (5') TCACTTCAAAAGTCCTGAACT (3') (c) tRNA1Tyr (su+), the first gene in the doublet strain phi80psu+-III, has the sequence (5') TAATTCACCACAGGG (CA) (3'), and tRNA2Tyr in lambdah80dglyTsu+36 has the sequence (5') ATTTCGGCCACGCGA (TGCGG) (3') beyond the C-C-A nucleotides.

Base Sequence↗
PubMed1976

Complete nucleotide sequence of bacteriophage MS2 RNA: primary and secondary structure of the replicase gene.

Bacteriophage MS2 RNA is 3,569 nucleotides long. The nucleotide sequence has been established for the third and last gene, which codes for the replicase protein. A secondary structure model has also been proposed. Biological properties, such as ribosome binding and codon interactions can now be discussed on a molecular basis. As the sequences for the other regions of this RNA have been published already, the complete, primary chemical structure of a viral genome has now been established.

Base Sequence↗
PubMed1976

The initiation region of the SV40 VP1 gene.

The sequence of 15 nucleotides located at the 5' terminus of the plus strand of the SV40 Hind K fragment has been determined as (5') A-G-C-T-T-A-T-G-A-A-G-A-T-G-G (3'). The 3' on OH terminal G of this segment is part of the G-C-C codeword for the N terminal alanine of the VP1 protein. This region therefore presumably corresponds to a ribosome binding site on the 16S late mRNA. Complementarily to the 3' OH of eucaryotic 18S ribosomal RNA and homology with the BMV coat ribosome binding site are discussed.

Bacterial Proteins↗