Biomedical subjects

R C Hardison

Publications and source records attributed to R C Hardison.

At least 55 records · Page 3Linked to original sources

PubMed1986

A previously undetected pseudogene in the human alpha globin gene cluster.

The sequence of the DNA between two pseudogenes in the human alpha-like globin gene cluster has been determined. Comparison of this sequence with sequences from other alpha-like globin gene clusters revealed another pseudogene, psi alpha 2, between the previously recognized pseudogenes zeta 1 and psi alpha 1. Therefore, the human alpha-like globin gene family is organized 5'-zeta 2-zeta 1-psi alpha 2-psi alpha 1-alpha 2-alpha 1-3'. The new pseudogene psi alpha 2 is very close to zeta 1, beginning only 65 base pairs 3' to the polyadenylation site of zeta 1. The first exon and the first intron of psi alpha 2 are interrupted by large inserts which are flanked by short (6 to 8 base pairs) direct repeats. The pseudogene psi alpha 2 lacks a promoter for transcription by RNA polymerase II, the first exon is highly divergent, one splice site is mutated, and five different frameshift mutations have occurred in the coding regions. Thus psi alpha 2 cannot encode a globin polypeptide. This pseudogene was not recognized in previous hybridization analyses of the human alpha-like globin gene cluster, and our discovery of it by sequence analysis suggests that divergent copies of a large number of genes may comprise a substantial fraction of the slowly renaturing DNA of mammalian genomes.

Base Sequence↗

PubMed1986

Isolation and nucleotide sequence of the rabbit globin gene cluster psi zeta-alpha 1-psi alpha. Absence of a pair of alpha-globin genes evolving in concert.

A cloned 13.3-kilobase (kb) region of rabbit genomic DNA contains a cluster of alpha-like globin genes arranged 5'-psi zeta-(3.6 kb)-alpha 1-(2.2 kb)-psi alpha-3'. Genomic blot hybridization data show that this is the major alpha-like globin gene cluster in rabbits, although a second alpha-globin gene (alpha 2) is also detected. Repetitive sequences from the C family of short repeats flank the psi zeta gene, and a new repetitive element, the F repeat is located 3' to psi alpha. The sequence was determined for a 4024-base pair (bp) segment that extends from 149 bp 5' to the cap site of alpha 1 to 207 bp 3' to psi alpha. Gene alpha 1 is functional and encodes one of the major allelic variants of rabbit alpha-globin. This gene has very short introns (77 bp in intron 1 and 83 bp in intron 2) and an unusual ATA box in the 5' flanking region (CTTAAA), which does function to promote transcription by RNA polymerase II in a cell-free system. Short (4 or 9 bp) G + C-rich repeats are interspersed throughout the flanking regions and the introns. Gene psi alpha cannot encode a globin polypeptide, and it is probably inactive. This is shown by the absence of a normal globin gene promoter, the replacement of the 5' untranslated sequence by tandem repeats of the sequence GCCCGCCGC, frameshift deletions in exon 2, and the modification of the polyadenylation signal to AGTAAA. The intergenic region between alpha 1 and psi alpha is very G + C rich (65.7% G + C) and contains many short, tandem repeats. Gene psi zeta hybridizes specifically to a human zeta-globin gene probe, but a partial sequence reveals frameshift mutations that probably make psi zeta a pseudogene. Mammalian alpha-globin gene clusters vary in the presence or absence of pseudogenes, and if present, the position of the pseudogene differs in various gene clusters. Among the mammalian alpha-like gene clusters so far analyzed, the rabbit gene cluster is unique in the absence of duplicated alpha-globin genes that are undergoing concerted evolution.

Animals↗

PubMed1986

Long interspersed L1 repeats in rabbit DNA are homologous to L1 repeats of rodents and primates in an open-reading-frame region.

Determination of the DNA sequence of a cluster of repetitive elements located 3' to the rabbit beta-1 globin gene shows that previously identified B, E, and D repeats are linked to form a long repeat. The B and E regions are homologous to the L1 long interspersed repeats of primates and rodents. Thus L1 repeats are widely dispersed in several different mammalian orders. The sequence similarity among L1 repeats from three species is limited to a long segment that contains extensive open reading frames. This conserved region is followed by a highly divergent segment that corresponds to a 3' untranslated region. The conservation of sequences in the open-reading-frame region coupled with the divergence of the untranslated region supports the hypothesis that the L1 repeats are derived from transcripts of a functional gene that encodes a protein.

Animals↗

PubMed1986

Assignment of orthologous relationships among mammalian alpha-globin genes by examining flanking regions reveals a rapid rate of evolution.

In order to study the relationships among mammalian alpha-globin genes, we have determined the sequence of the 3' flanking region of the human alpha 1 globin gene and have made pairwise comparisons between sequenced alpha-globin genes. The flanking regions were examined in detail because sequence matches in these regions could be interpreted with the least complication from the gene duplications and conversions that have occurred frequently in mammalian alpha-like globin gene clusters. We found good matches between the flanking regions of human alpha 1 and rabbit alpha 1, human psi alpha 1 and goat I alpha, human alpha 2 and goat II alpha, and horse alpha 1 and goat II alpha. These matches were used to align the alpha-globin genes in gene clusters from different mammals. This alignment shows that genes at equivalent positions in the gene clusters of different mammals can be functional or nonfunctional, depending on whether they corrected against a functional alpha-globin gene in recent evolutionary history. The number of alpha-globin genes (including pseudogenes) appears to differ among species, although highly divergent pseudogenes may not have been detected in all species examined. Although matching sequences could be found in interspecies comparisons of the flanking regions of alpha-globin genes, these matches are not as extensive as those found in the flanking regions of mammalian beta-like globin genes. This observation suggests that the noncoding sequences in the mammalian alpha-globin gene clusters are evolving at a faster rate than those in the beta-like globin gene clusters. The proposed faster rate of evolution fits with the poor conservation of the genetic linkage map around alpha-globin gene clusters when compared to that of the beta-like globin gene clusters. Analysis of the 3' flanking regions of alpha-globin genes has revealed a conserved sequence approximately 100-150 bp 3' to the polyadenylation site; this sequence may be involved in the expression or regulation of alpha-globin genes.

Animals↗

PubMed1986

Restriction enzyme analysis of tomato chloroplast and chromoplast DNA.

Plastid DNA was isolated from the chloroplasts of tomato (Lycopersicon esculentum var Traveler 76) leaves and the chromoplasts of ripe tomato fruit. Comparisons of the two DNAs were made by restriction endonuclease analysis using PvuII, HpaI, and Bg1I. No differences in the electrophoretic banding patterns of the restricted plastid DNAs were detected, indicating that no major rearrangements, losses, or gains of plastid DNA accompany the transition from chloroplast to chromoplast.

Journal Article↗

PubMed1985

DNase I and nuclease S1 sensitivity of the rabbit beta 1 globin gene in nuclei and in supercoiled plasmids.

We have examined the nuclease sensitivity of the 5' flanking region of the rabbit beta 1 globin gene in bone marrow nuclei and in supercoiled plasmids. A DNase I hypersensitive site was found about 100 base-pairs 5' to the cap site in bone marrow nuclei. S1 nuclease can introduce a specific double-strand cut in the DNA in the same region. The presence of the nuclease-hypersensitive region correlates with the active transcription of gene beta 1 in bone marrow. Treatment with nuclease S1 of a supercoiled plasmid containing 1400 base-pairs of 5' flanking sequences as well as part of the beta 1 gene reveals a major double-strand cut 400 base-pairs 5' to the cap site. This cut maps within a stretch of repeating dinucleotides (C-T)12 and does not correspond to the in vivo site. Introduction of an RsaI fragment containing the nuclease S1-hypersensitive site into plasmid pBR322 shows that this fragment alone is sufficient to generate the hypersensitive site. Deletion of that RsaI fragment from the beta 1 plasmid reveals another site 1300 base-pairs upstream. Further deletion of this secondary site uncovers numerous other sites, none of which corresponds to the site in nuclei. Chromatin reconstitution with plasmids carrying the 5' flanking region of beta 1 and histones is capable of suppressing the in vitro nuclease-S1-hypersensitive site at --400 but is incapable of generating the in vivo site at --100. Fine analysis at the nucleotide level of the early events in the digestion with nuclease S1 shows that the enzyme attacks preferentially the sequence (G-A)12 on the message complementary strand. The region of DNA containing the supercoil-dependent S1 site adopts at least three different conformations that can be resolved electrophoretically. These different conformations are detected in linear restriction fragments and may represent non-B DNA or unusual B-form DNA.

Animals↗

PubMed1985

Variability within the rabbit C repeats and sequences shared with other SINES.

The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence TCCCAGCAACCACATGGGAGGCAGAGA was found in all mammalian SINES examined. The 3' portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.

Animals↗

PubMed1985

Transcription unit of the rabbit beta 1 globin gene.

We have hybridized pulse-labeled nuclear transcripts to cloned DNA fragments from the rabbit beta-like globin genes to determine the developmental timing, extent, and asymmetry of their transcription. The fetal-adult gene beta 1 was transcribed in fetal liver but not embryonic nuclei, whereas genes beta 3 and beta 4, which encode embryonic globin polypeptides, were transcribed only in embryonic nuclei. This shows that the switch from embryonic to fetal-adult globin production in rabbits is accomplished primarily by differential transcription of the beta-like globin genes. Gene beta 1 was subdivided into M13 subclones and tested for hybridization to nascent RNA. The nucleotide sequence of the 3' flanking region of gene beta 1 was also determined for 2,447 base pairs past the polyadenylation [poly(A)] site. No transcripts were found 5' to the cap site, but asymmetric transcription of gene beta 1 proceeded at a high level through the gene and past the poly(A) addition site for 603 nucleotides. The level of transcription declined after this, gradually dropping through the next 568 nucleotides. No polymerases were found on a fragment that begins 1,707 nucleotides past the poly(A) site; this fragment was part of a segment of repetitive DNA. These data show that the transcription unit of gene beta 1 begins at or near the cap nucleotide and extends at least 1,171 but no more than 1,706 nucleotides past the poly(A) addition site. The DNA segment that precedes the region of declining transcription contained an inverted repeat and encoded a short RNA transcribed by RNA polymerase II from the strand opposite the beta 1 transcript. These two features may function to attenuate the transcription of gene beta 1. An inverted repeat and a potential polymerase II transcription unit were also found in the homologous segment 3' to the human beta-globin gene. A short DNA segment close to the 3' end of the beta 1 transcription unit was transcribed more actively than the surrounding DNA, and it contained sequences that match the consensus internal control region for RNA polymerase III. This DNA segment may contain a separate polymerase III transcription unit. A member of the D repeat family located 3' to gene beta 1 was not transcribed in its entirety coordinately with beta 1.

Animals↗

PubMed1984

The rabbit C family of short, interspersed repeats. Nucleotide sequence determination and transcriptional analysis.

The C repeat family was first observed in the rabbit beta-like gene family. We have estimated the repetition frequency of the C repeats, determined the nucleotide sequence of three intact members and one truncated member, and have investigated the size, tissue specificity, and intracellular localization of C repeat transcripts. Members of the C repeat family are short (average size of 316 base-pairs) and are repeated about 170,000 times per haploid genome in a widely dispersed pattern. They end in a 3' poly(dA) tract and are flanked by direct repeats that range in size from 8 to 16 base-pairs. The consensus internal control regions for polymerase III transcription are located near the 5' end. Different amounts of C repeat RNA accumulate in a variety of tissues, and most of the transcripts are confined to the nucleus. A heterogeneous distribution of C repeat RNA sizes was found, ranging from about 330 to 8200 nucleotides. These structural and transcriptional properties are similar to those of primate and rodent Alu and Alu-like repeats. However, the C repeats are not similar in sequence to the Alu repeats. Thus two different types of short, interspersed repeats capable of being transcribed and proposed to be transposable elements have now been identified in mammals. The positions of these short repeats in mammalian beta-like globin gene families are not tightly conserved.

Animals↗

PubMed1984

Rabbit globin pseudogene psi beta 2 is a hybrid of delta- and beta-globin gene sequences.

The evolutionary history of the rabbit globin pseudogene psi beta 2 was studied by completing its nucleotide sequence and aligning the sequence with that of the rabbit adult globin gene beta 1 and the human minor adult globin gene delta. The 5' flanking region and exon 1 of psi beta 2 were most similar to rabbit beta 1, but the large intervening sequence and the 3' untranslated region were most similar to human delta. Intron 1 and exon 2 were equally similar to both delta and beta 1. This pattern indicates that psi beta 2 was originally a delta-like gene that acquired the 5' portion of gene beta 1 by intrachromosomal gene conversion. The presence of a delta-globin gene sequence in both rabbits and humans shows that it is an ancient gene, predating the mammalian radiation that occurred over 85 Myr ago. Delta has shown a pronounced tendency to be altered in its 5' end during the course of mammalian evolution. Quantitative divergence analysis shows that the ancestor to rabbit psi beta 2 was active until 20-30 Myr ago, during which time the lagomorph beta-globin gene family apparently functioned without a pseudogene.

Animals↗

PubMed1984

Comparison of the beta-like globin gene families of rabbits and humans indicates that the gene cluster 5'-epsilon-gamma-delta-beta-3' predates the mammalian radiation.

The members of the rabbit and human beta-like globin gene families have been compared both by a computer-generated dot matrix graphical analysis of each entire gene and by calculating divergences in the coding regions. The rabbit-human gene pairs beta 4-epsilon, beta 3-gamma, psi beta 2-delta, and beta 1-beta were identified as orthologous on the basis of sequence similarities found in flanking and intervening sequences as well as by quantitative divergence calculations. The orthologous genes are in the same order on the chromosome in each species, which suggests that an ancestral family with the arrangement 5'-epsilon-gamma-delta-beta-3' preceded the mammalian radiation. Descendants of ancestral epsilon have diverged more slowly than other beta-like genes and are expressed only in embryonic life. Descendants of ancestral gamma and beta diverged at a higher rate and are expressed at wider range of developmental times. Descendants of delta have undergone nonreciprocal recombination at a high frequency and are often pseudogenes. Paralogous comparisons among the rabbit beta-like globin genes show that the beta 4-beta 3 and psi beta 2-beta 1 pairs are most similar and that beta 4 and beta 3 are more closely related to beta 1 than to psi beta 2. This fits with a branching pattern where the primordial beta split into ancestral epsilon/gamma and delta/beta genes, which later split into epsilon and gamma or delta and beta, respectively. Rabbit genes beta 4 and beta 1 acquired similar 3' untranslated regions after the epsilon/gamma split but prior to the mammalian radiation, presumably via a gene conversion event. The 5' end of beta 2 apparently converted with beta 1 after the radiation, and afterward it became a pseudogene.

Animals↗

PubMed1983

The nucleotide sequence of the rabbit embryonic globin gene beta 4.

In the rabbit, two beta-like globin genes, beta 3 and beta 4, are expressed in embryonic erythrocytes and one, beta 1, is expressed in fetal and adult erythrocytes. The complete nucleotide sequence of embryonic gene beta 4 is presented, including the region from 582 base pairs before the cap site to 508 base pairs after the poly(A) addition site. beta 4 has the tripartite structure characteristic of animal globin genes, being interrupted by intervening sequences within codon 30 and between codons 104 and 105. Conserved sequences thought to play roles in transcription, RNA processing, and translation are found in beta 4. Rabbit gene beta 4 shows substantial homology to the human embryonic epsilon-globin gene, not only in message-coding blocks, but also in the 5' and 3' flanking regions and in the two intervening sequences. Comparison of all four rabbit beta-like genes with those of humans suggests that a primordial four gene family, 5'-epsilon-gamma-delta-beta-3', existed prior to the mammalian radiation. An alignment of the 5' flanking sequences of a collection of animal beta-like globin genes shows some conserved regions that differ between the adult genes and the embryonic/fetal genes. These could reflect a common evolutionary lineage rather than stage-specific control sequences.

Amino Acid Sequence↗

PubMed1983

Analysis of rabbit beta-like globin gene transcripts during development.

We have analyzed the differential expression of a family of beta-like globin genes during the development of rabbits, from four days post implantation to one week before birth. The family is composed of four genes, arranged 5'-beta 4-beta 3-psi beta 2-beta 1-3' on the chromosome; psi beta 2 is an inactive pseudogene. Using the technique of hybrid-arrested translation in vitro, we have identified the embryo-specific globin polypeptides encoded by genes beta 3 and beta 4. The beta 3 and beta 4 globins are replaced by the adult beta 1 globin halfway through gestation; this corresponds temporally with the switch in site of erythropoiesis from the embryonic yolk sac to the fetal liver. The decline in production of beta 3 globin polypeptide precedes the decline in beta 4 globin. Transcripts from genes beta 1, beta 3 and beta 4 were analyzed at progressive stages of gestation by a blot-hybridization assay and by an S1 nuclease protection assay. Mature messenger RNA and presumptive precursor RNAs from genes beta 3 and beta 4 are synthesized abundantly in embryonic erythroid cells but only at very low levels later in fetal development. Conversely, precursor and mature mRNA from gene beta 1 are found at very low levels in embryos but are abundant in fetal and adult erythroid cells. The co-ordinate appearance of precursor RNA, mRNA and polypeptide from all three active genes indicates that the primary developmental regulation of this gene family is exerted at the level of transcription. RNA species larger than the expected precursors were observed when the RNA was denatured with formaldehyde but not when methylmercury was the denaturant. These large RNAs are a formaldehyde-generated artifact, possibly a result of cross-linking globin transcripts to ribosomal RNA. We observe no extensive stable transcripts from the 5' or 3' flanking regions of these genes.

Animals↗

PubMed1981

The nucleotide sequence of rabbit embryonic globin gene beta 3.

The nucleotide sequence of a rabbit embryonic globin gene, beta 3, has been determined from 161 base pairs (bp) on the 5' side of the mRNA cap site to 209 base pairs beyond the 3' poly A addition site. The 5' and 3' ends of mRNA from both embryonic globin genes beta 3 and beta 4 have been determined by an S1 protection assay. Sequences that are highly conserved in the 5' flanking region of eukaryotic structural genes, AATAAAA and CCAAT, are located -25 to -31 nucleotides and -81 to -85 nucleotides, respectively, before the cap site. The CCAAT sequence is duplicated at -108 to -112 nucleotides, as it is in the human fetal gamma-globin genes. Small (124 bp) and large (817 bp) intervening sequences are located between codons 30 and 31 and between 104 and 105, respectively. The sequence AATAAA precedes the predominant poly(A) addition site by 19 nucleotides. Although rabbit globin gene beta 3 is transcribed and translated almost exclusively in embryonic erythrocytes, it shares striking homology with the human gamma-globin genes which are expressed in erythrocytes from fetal liver. The evolutionary conservation of rabbit beta 3 and human gamma correlates well with their similar chromosomal positions in the two genes families.

Amino Acid Sequence↗

PubMed1979

The linkage arrangement of four rabbit beta-like globin genes.

Four different regions of rabbit beta-like globin gene sequences designated beta 1, beta 2, beta 3 and beta 4 were identified in a set of clones isolated from a bacteriophage lambda library of chromosomal DNA fragments (Maniatis et al., 1978). Restriction mapping and blot hybridization (Southern, 1975) studies indicate that a subset of these clones containing beta 1 and beta 2 hybridizes to an adult beta-globin cDNA clone (Maniatis et al., 1976) more efficiently than to a human gamma-globin cDNA clone (Wilson et al., 1978), while another subset containing beta 3 and beta 4 displays the converse hybridization specificity. beta 1 was identified as the adult beta-globin gene, while beta 2, beta 3 and beta 4 have not been identified with any known rabbit globin polypeptides. Cross-hybridization and transcriptional orientation experiments indicate that the set of beta-like gene clones contains overlapping restriction fragments encompassing 44 kb of rabbit chromosomal DNA. In addition, all four genes have the same transcriptional orientation and are arranged in the order 5'-beta 4-beta 3-beta 2-beta 1-3'.

Animals↗

PubMed1979

The structure and transcription of four linked rabbit beta-like globin genes.

Rabbit chromosomal DNA contains a cluster of four linked beta-like globin genes arranged in the orientation 5'-beta 4-(8kb)-beta 3-(5 kb)-beta 2-(7-kb)-beta 1-3'. Determination of the nucleotide sequence of gene beta 1 confirms that this gene corresponds to the second type of two common co-dominant alleles encoding the adult beta-globin chain. With the exception of two nucleotide substitutions in the large intervening sequence (intron), the intron and flanking sequences are identical with the nucleotide sequence of the first type determined by Weissmann et al. (1979). A 14S polyadenylated transcript containing large intron sequences (possibly a mRNA precursor) is detected in the bone marrow cells of anemic rabbits. Gene beta 2 has limited sequence homology to adult and embryonic beta-globin probes and lacks a detectable mRNA transcript in the erythropoietic tissues examined. It contains at least one intervening sequence analogous to the large intron in gene beta 1. Genes beta 3 and beta 4 both contain an intron of 0.8 kb. Partial DNA sequence analysis indicates that the large intron in beta 4 is located between codons for amino acids lysine and leucine in an analogous position to that of the large intron in beta 1. In addition, a second smaller intron interrupts the 5' coding sequences of gene beta 4. Both genes beta 3 and beta 4 are transcribed in embryonic globin-producing cells. Their DNA sequence homology is limited, however, to a segment of approximately 0.2 kb located on the 5' side of the large intron.

Animals↗

PubMed1978

The isolation of structural genes from libraries of eucaryotic DNA.

We present a procedure for eucaryotic structural gene isolation which involves the construction and screening of cloned libraries of genomic DNA. Large random DNA fragments are joined to phage lambda vectors by using synthetic DNA linkers. The recombinant molecules are packaged into viable phage particles in vitro and amplified to establish a permanent library. We isolated structural genes together with their associated sequences from three libraries constructed from Drosophila, silkmoth and rabbit genomic DNA. In particular, we obtained a large number of phage recombinants bearing the chorion gene sequence from the silkmoth library and several independent clones of beta-globin genes from the rabbit library. Restriction mapping and hybridization studies reveal the presence of closely linked beta-globin genes.

Base Sequence↗

PubMed1977

Histone neighbors in nuclei and extended chromatin.

Histone neighbors in compact and extended chromatin have been investigated by cross-linking histones in nuclei and in nucleohistone extended with 6 M urea, using the bifunctional reversible reagent methyl-4-mercaptobutyrimidate (MMB). Similar histone dimers are found in both conformational states of chromatin. The dimers most frequently found are H2b-H2a, H2b-H3 and H3-H2a; dimers found less frequently are H3-H4, H3-H3 and H2b-H4. More H3-H3 is found in nuclei than in extended chromatin. H1 is found predominantly as poly-H1, although it can be cross-linked to H2b or H3. After reaction with MMB, native compact chromatin is no longer extendable in 6 M urea, which shows that the reagent is capable of linking together histones holding the chromatin in a compact conformation. Thus the histone propinquity in extended chromatin mimics and intimate histone associations in compact chromatin.

Cell Nucleus↗