Search PubMed⌕ Search

Biomedical subjects

R C Elkins

Publications and source records attributed to R C Elkins.

At least 37 records · Page 2Linked to original sources
PubMed1997

Chromosomal localization of a human mucin gene (MUC8) and cloning of the cDNA corresponding to the carboxy terminus.

A partial cDNA (pAM1) encoding a major airway mucin glycoprotein with novel tandem repetitive sequence has recently been cloned (Shankar, V., M. S. Gilmore, R. C. Elkins, and G. P. Sachdev. 1994. Biochem. J. 300:295-298). In this article, we report additional new sequence derived by 3'-rapid amplification of cDNA ends technique. The sequence corresponds to a stop codon, 3'-untranslated region of 458 bp, a polyadenylation signal, and poly A+ tail, and represents the extreme carboxy terminus of MUC8. A plasmid construct (pAM3) in pBluescript was generated by in-frame ligation of pAM1 to the 479-bp 3'UTR of MUC8. A 5'-end 325-bp fragment of this cDNA subcloned into the protein fusion and expression vector pET28b(+) was used to generate fusion protein under the control of T7 promoter. The purified fusion protein as well as synthetic peptide corresponding to the MUC8 repeat sequence (TSCPRPLQEGTPGS) were used to raise polyclonal antibodies in rabbits. The antiserum to the fusion protein and to the synthetic peptide reacted with the deglycosylated major tracheobronchial mucin. Immunohistochemical studies using the above antibodies localized the MUC8 protein product to submucosal glands in human tracheal epithelium. Furthermore, the gene from which this cDNA is derived, was mapped to chromosome 12 using DNA from a panel of human-mouse somatic cell hybrids. Fluorescence in situ hybridization was used to assign the regional localization to 12q24.3. Since the eight known human mucin genes map to other chromosomes, we have named this gene MUC8, in accordance with mucin gene nomenclature.

Amino Acid Sequence↗
PubMed1997

Evaluation of cryopreserved homografts in the right ventricular outflow tract after the Ross procedure: intermediate-term follow up.

BACKGROUND AND AIMS OF THE STUDY: The Ross procedure involves replacing a transplanted pulmonary valve with a cryopreserved homograft in order to re-establish right ventricle-pulmonary artery continuity. This study reviews mid-term results of such surgery in children and young adults. METHODS: Since November 1986, 114 patients have undergone the Ross procedure at the Children's Hospital of Oklahoma using cryopreserved pulmonary homografts (n = 113) and aortic homograft (n = 1) to reconstruct the right ventricular outflow tract. Graft size ranged from 16 to 32 mm. Ninety-three patients (mean age at implant 10.4 years (range: 0.8-22 years) have had complete mean follow up of 3.2 years (range: 5 months to 8.4 years) after surgery. Homograft evaluation included clinical reports and comparison of early post-implant and latest echocardiography. Measurements of homograft valve annulus and peak instantaneous Doppler gradient were compared; quality of valve leaflets, location of obstruction, and the degree of pulmonary regurgitation were assessed. RESULTS: Compared with early postoperative data, mean homograft annulus size decreased by 15% (p < 0.0001); in 88% of patients, the decrease ranged from one to nine millimeter. Peak Doppler gradient increased significantly (from 10 to 17 mmHg, p < 0.0001); 25% of patients developed gradients > 25 mmHg, and four had gradients > 50 mmHg. Significant obstruction developed most often at the supravalvular level or in the homograft conduit itself. This usually occurred within one year of implant, and was associated with calcification and contracture of the homograft wall. Significant pulmonary regurgitation developed in 19 cases (20%), but was more than mild in only three. Leaflet integrity was maintained except in those who developed severe stenosis or regurgitation. Two patients have undergone re-operation for homograft stenosis 2.8 and 5.4 years respectively after the Ross procedure; one has developed recurrent severe stenosis in the homograft four months later. CONCLUSIONS: After the Ross procedure: (i) Pulmonary homografts undergo significant annular reduction in most patients, though this is usually not associated with the development of significant obstruction. (ii) Peak Doppler gradients across the homograft increase in most patients, though only 4% develop more than mild obstruction. (iii) Mild pulmonary regurgitation is common (20%); moderate or severe regurgitation is rare and usually develops in concert with severe stenosis. (iv) Severe homograft valve degeneration usually occurs within one year of implant, and may reflect an immune-mediated response.

Adolescent↗
PubMed1996

Pulmonary autografts in patients with aortic annulus dysplasia.

BACKGROUND: Pulmonary autograft replacement of the aortic valve is indicated in the young, in patients with an active life style, and when anticoagulation is contraindicated. Its use in patients with a dilated aortic annulus or sinotubular junction has historically had a less satisfactory result. METHODS: To extend the advantages of the pulmonary autograft to this group of patients, we performed the Ross operation as a root replacement and "fixed" and narrowed the aortic annulus with external woven Dacron in 12 patients, Teflon felt in 5, and pericardium in 3. Twenty patients, aged 7 to 47 years (median, 27 years), are reported to assess the effectiveness of this operative technique. Preoperative aortic annulus diameter was 23 to 33 mm (13 were >27 mm). RESULTS: There were no operative or late deaths. Early postoperative, echocardiographic evaluation of autograft valve function revealed no significant obstruction, grade 0 aortic insufficiency in 5, trace to 1+ in 12, and 2+ in 2. Late evaluation of 1 to 4 years is available in 12 patients and has shown no increase in autograft insufficiency. CONCLUSIONS: This experience suggests that operative fixation of the aortic annulus with an external Dacron cuff is effective and is recommended in patients with an aortic annulus that is significantly greater than normal for their body size.

Adolescent↗
PubMed1996

Pulmonary autograft reoperation: incidence and management.

BACKGROUND: Pulmonary autograft replacement of the aortic valve is accepted in the young, those with an active life style, and those who are not candidates for anticoagulation. However, concern remains about autograft or homograft valve failure. METHODS: One hundred ninety-five operative survivors of the Ross operation (August 1986 through December 1995) were reviewed for operative pathology and factors associated with reoperation or valve dysfunction. RESULTS: Actuarial freedom from reoperation (autograft or homograft) is 89% +/- 3% at 5 years, 92% +/- 3% for the autograft alone. Early autograft valve failures (< 6 months) were due to technical error in 2 patients and persistent endocarditis in 1. Late autograft valve failure (1 to 6.2 years) was due to aortic annulus dilatation in 5 patients, bacterial endocarditis in 1, and valve degeneration in 2. Six autograft valves were replaced and five were repaired. Five patients required reoperation for pulmonary homograft stenosis (1 to 5.4 years) involving obstruction of the conduit distal to the pulmonary valve. CONCLUSIONS: Pulmonary autograft replacement of the aortic valve has a low incidence of reoperation for autograft dysfunction or homograft obstruction. Autograft dysfunction can be corrected by autograft repair in patients with central insufficiency and aortic annular dilatation.

Actuarial Analysis↗
PubMed1996

The Ross operation: applications to children.

The Ross operation is the operation of choice for children requiring an aortic valve replacement. It is associated with a low surgical mortality and late morbidity and does not require anticoagulation. It allows a growing child to have a near-normal lifestyle with a limited risk of reoperation for autograft valve or homograft valve failure.

Adolescent↗
PubMed1995

Associated atrial septal defects increase perioperative morbidity after ventricular septal defect repair in infancy.

Although closure of ventricular septal defects (VSDs) is currently associated with a relatively low risk, infants with associated atrial septal defects (ASDs) seem to have a higher perioperative morbidity. To clarify this impression, we reviewed our entire experience (since 1977) with closure of simple VSDs in 163 infants (age, < or = 12 months). Of these, 57 had significant ASDs (ASD-VSD subgroup). Hospital mortality was 3.7% (6/163) overall and 1.4% (2/145) since 1980. Actuarial survival at 10 years was 92% +/- 5%. Significant morbidity occurred in 15.5% (16/103) of the VSD subgroup versus 48.1% (26/54) of the ASD-VSD subgroup (p < or = 0.001). Multivariate analysis identified the presence of multiple VSDs and early date of operation as risk factors for hospital death, and younger age, an associated ASD, the size of the VSD, and use of hypothermic circulatory arrest as risk factors for significant perioperative morbidity. Compared with the VSD subgroup, the ASD-VSD subgroup had a higher hospital mortality (5.3% [3/57] versus 2.8% [3/106]), were younger (5.1 +/- 2.9 versus 7.2 +/- 2.9 months; p = 0.001), had a higher preoperative pulmonary artery pressure (70.2 +/- 19.0 versus 62.7 +/- 21.8 mm Hg; p = 0.08), needed more inotropic support (12.3% versus 3.7%; p = 0.07), needed more prolonged ventilation (3.3 versus 1.8 days; p = 0.02), and had longer postoperative hospital stays (11 versus 8 days; p = 0.005).(ABSTRACT TRUNCATED AT 250 WORDS)

Age Factors↗
PubMed1995

Modified hemi-Fontan operation: an alternative definitive palliation for high-risk patients.

BACKGROUND: We conceptualized that by adding small amounts of prograde pulmonary blood flow to the hemi-Fontan operation, or bidirectional Glenn procedure, this modified hemi-Fontan operation could be safely done at an early age, with better oxygenation, and with less potential for pulmonary arteriovenous fistulae. METHODS: Since April 1992 the hemi-Fontan operation was modified by adding some prograde flow through the native pulmonary artery in 10 high-risk infants, either by leaving the critical subpulmonary stenosis untreated (n = 6) or by tightening a previously placed pulmonary artery band (n = 4). All other sources of pulmonary blood flow were interrupted. Patients were 4 to 23 months old (3.8 to 10.3 kg). Diagnoses included isolated dextrocardia with single ventricle (3) and polysplenia syndrome (2). Cardiopulmonary bypass was needed in 5 patients. RESULTS: There were no hospital deaths. Mean postoperative intensive care unit stay was 2 days, and 9 of 10 patients were discharged within 7 days of operation. One 4-month-old infant with Down's syndrome survived postoperative takedown of the hemi-Fontan repair after pneumonia and caval thrombosis developed. Eight patients are currently asymptomatic receiving minimal modification, and oxygen saturations range from 84% to 93%. CONCLUSIONS: Adding small volumes of prograde pulmonary blood flow to the hemi-Fontan operation is safe, provides improved oxygenation, may encourage growth of central pulmonary arteries, and represent an alternative definitive palliation for high-risk Fontan candidates.

Child, Preschool↗
PubMed1994

A novel human airway mucin cDNA encodes a protein with unique tandem-repeat organization.

Highly specific affinity-purified polyclonal antibodies against deglycosylated human tracheobronchial mucin was used to select immunoreactive clones from a Uni-ZAP cDNA expression library prepared from normal human tracheal mRNA. The largest of three positive clones, designated pAM1, which reacted strongly with the polyclonal antibodies, was further characterized. Sequence analyses revealed a partial 941 bp cDNA that encoded a 313-amino-acid polypeptide. Bases 3-892 consisted of imperfect 41-nucleotide tandem repeats (CCAGGAGGGGACACCGGGTTCACGAGCTGCCCACGCCCTCT) that encoded a unique polypeptide with two types of consensus repeats, TSCPRPLQEGTRV and TSCPRPLQEGTPGSRAAHALSRRGHRVHELPTSSPGGDTGF. The overall composition of the deduced amino acid sequence matched that expected for a mucin protein core and is rich in serine, threonine, proline, glycine and alanine (approximately 51%). Northern blots probed with the mucin cDNA exhibited intense polydisperse hybridization bands with RNA isolated from normal human trachea and cystic-fibrosis bronchus. The data indicate that mucin encoded by clone pAM1 represents a unique type of peptide organization which has not been described in mucin cDNAs reported thus far.

Amino Acid Sequence↗
PubMed1994

Pulmonary autograft in children: realized growth potential.

Pulmonary autograft replacement of the aortic valve has the potential to remain viable and grow in proportion to the somatic growth of the child. Changes in aortic annulus and sinotubular dimensions were compared early and late postoperatively, and related to normal. Eighty-six children, 0.9 to 21 years, were operated on between 1986 and 1993: 42 had a root replacement, 24 an inclusion cylinder, and 20 a scalloped subcoronary implant. Actuarial survival at 7 years was 96.5% +/- 2.0%. Freedom from reoperation for the pulmonary autograft or the homograft reconstruction of the right ventricular outflow tract was 92% +/- 4%. Freedom from reoperation on the autograft in root replacements was 96% +/- 4%, in the inclusion cylinder was 100%, and in the scalloped subcoronary was 90% +/- 7% (not significant). Aortic annulus and sinotubular junction diameters were compared with normal values predicted by body surface area. In 22 intraaortic implants, early and late postoperative annulus diameter mean Z values are in the normal range. In the 23 root replacements, early annulus diameter was within the normal range, but late Z values were larger than normal (p < 0.02). Intraaortic implant annulus diameter increased proportionally to somatic growth, but the sinotubular junction, which was small, remained small but increased toward normal. In the root replacements, the annulus increased in diameter and became dilated. The sinotubular junction, which was small early, increased and was within the normal range late. Lower operative risk and valve durability without failure suggest improved results with inclusion cylinder technique.(ABSTRACT TRUNCATED AT 250 WORDS)

Adolescent↗
PubMed1994

Homograft replacement of the aortic valve and root as a functional unit.

Homograft replacement of the aortic valve has inherent advantages for the patient in terms of decreased incidence of thromboembolism, endocarditis, and anticoagulation-related complications. Limitations in its use stem from a significant incidence of postoperative aortic regurgitation, related to difficulty with consistent commissural and sinotubular geometry when inserted in the subcoronary position. To minimize this complication, we used a homograft as a functional unit in 71 patients between 1986 and May 1993, either as a root replacement (n = 58) or as an intraaortic inclusion cylinder (n = 13). There were 4 pulmonary and 67 aortic homografts. Mean age of the 16 female and 55 male patients was 42 +/- 19 years (range, 0.6 to 84 years). Thirty patients had predominantly aortic regurgitation, 19 aortic stenosis, 18 mixed aortic valve disease, and 4 primary aneurysmal disease. Eighteen (25.4%) had infective endocarditis. Thirty-five patients (49%) had a previous operation on the aortic valve. Hospital mortality was 14.1% (10/71), 0% for inclusion cylinders and 17.2% (10/58) for root replacements (p = not significant). Recent follow-up was obtained in all hospital survivors. Mean follow-up period was 35 months (range, 1 to 81 months). There were six late deaths, 1/13 for inclusion cylinders and 5/48 for root replacements. Actuarial survival at 5 years was 74.9% +/- 5.6%. Reoperation was required in 3 patients (all with root replacements), 1 for postoperative endocarditis, 1 for left coronary ostial obstruction, and 1 for late onset of aortic dilatation and regurgitation (pulmonary homograft used as a root replacement). Two patients currently have asymptomatic greater than 2/4 aortic regurgitation. Freedom from significant aortic regurgitation was 88% +/- 7% at 6-year follow-up. More consistent maintenance of the sinotubular and commissural geometry of the aortic homograft may be achieved with the root replacement or the inclusion cylinder techniques. This may reduce the incidence of postoperative aortic regurgitation and further benefit the patient by reducing the need for reoperation in the future.

Adolescent↗
PubMed1994

Ventricular function after the arterial switch operation for transposition of the great arteries.

The theoretical advantages of anatomical repair have resulted in the widespread use of the arterial switch operation for transposition of the great arteries. However, preservation of systemic ventricular performance and late functional results have not been well documented. To evaluate late postoperative ventricular function, we reviewed 53 consecutive patients undergoing arterial switch operation for transposition of the great arteries with or without a ventricular septal defect over the 8-year period from March 1985 to 1993. Forty-two patients had simple transposition of the great arteries and 11 patients had associated ventricular septal defects that were closed at operation. Mean age at operation was 1.8 months (range, 1 day to 36 months), and mean patient weight was 3.8 kg (range, 1.8 to 15.6 kg). All but 8 patients were neonates. There were six operative deaths (11.3%, 6/53) and two late deaths during a median follow-up of 23 months (range, 0.1 to 99.5 months). Actuarial survival at 8 years was 83% +/- 6%. Left ventricular outflow tract obstruction has not been identified, and 9 patients (20%, 9/45) have right ventricular outflow tract gradients exceeding 20 mm Hg, 3 of whom have required reoperation. Eighteen patients have mild neo-aortic valve regurgitation. All survivors are currently in New York Heart Association class I, and are in sinus rhythm. Systolic left ventricular function is well preserved with ejection fractions greater than 0.60 in all survivors followed up for more than 4 months (41 patients). Left ventricular end-diastolic volume index is elevated in only 1 patient, a patient who had pulmonary artery banding as a neonate.(ABSTRACT TRUNCATED AT 250 WORDS)

Abnormalities, Multiple↗
PubMed1994

Medium-term follow-up of pulmonary autograft replacement of aortic valves in children.

Pulmonary autograft replacement (PAG) of the aortic valve in children has been shown to be safe and effective with a low incidence of late valve dysfunction. Relief of all types of left ventricular outflow tract obstruction using the pulmonary root has been possible. Concern about the durability of the pulmonary root in the aortic position, and the potential for growth of the pulmonary autograft used either as a root replacement or intraaortic implant, has been questioned. Sixty-five consecutive patients, aged 1.8 to 21 years (mean 12 years) operated on between September 1986 and January 1993, 35 with an intra-aortic implant (IA) and 30 with root replacement (RR), were evaluated by clinical and serial echocardiographic studies (ECHO) up to 6.5 years post-operatively. The hospital mortality rate was 3.0% (70% CL 2.1-5.1%). Two patients required reoperation for PAG insufficiency (AI), one for technical malalignment necessitating replacement at 6 months, and one with progressive leaflet prolapse due to adherence of the valve leaflet to a ventricular septal defect (VSD) patch. Freedom from significant aortic regurgitation at 6-year follow-up was 100% for RR and 91 +/- 6% for IA, and freedom from all valve-related complications including reoperation was 92 +/- 5% at 6 years. Significant enlargement of the aortic annulus which parallels somatic growth has been measured by ECHO in 17 IA implants (P < 0.001) and 17 RR patients (P < 0.01) by 1 year, and in 10 IA (P = 0.007) and 6 RR (P < 0.05) by 2 years.(ABSTRACT TRUNCATED AT 250 WORDS)

Adolescent↗
PubMed1994

Pulmonary autograft replacement of the aortic valve in the potential parent.

Aortic valve replacement in the child and young adult is often delayed, and multiple operations or invasive procedures are performed to avoid valve replacements. Prosthetic valves, bioprosthetic valves, or allograft valves have been associated with significant complications or early failure and have been a disappointing solution for the patient requiring aortic valve replacement. The pulmonary autograft replacement (PAR) of the aortic valve in children has been shown to be safe and effective with a low incidence of late valve dysfunction. The absence of thromboembolism, the avoidance of anticoagulants, and its viability with the potential for growth and repair strongly support its use for the potential parent, patients of age 35 or less. The experience with 112 patients, 32 females and 80 males, ages 1.5 to 35 years (average 16.1) are reviewed. Twenty-four had aortic insufficiency, 34 had aortic stenosis, and 54 had both aortic stenosis and insufficiency. Actuarial survival was 95.4% +/- 2.0% at 7 years and freedom from reoperation or significant aortic insufficiency of the autograft valve was 92.7% +/- 3.7%. Freedom from all valve related complications of the autograft valve and the homograft replacement of the pulmonary valve was 90.0% +/- 4.0%. Reoperation for the autograft valve was related to limited experience in one, leaflet prolapse and adherence to a VSD patch in one, associated lupus erythematosus in one, and annular and sinotubular dilatation in one. Reoperation of the homograft valve in two patients was secondary to early homograft stenosis, probably due to rejection.(ABSTRACT TRUNCATED AT 250 WORDS)

Actuarial Analysis↗
PubMed1994

Gunshot wounds traversing the mediastinum: guidelines for evaluation and management.

When there is suspicion that a penetrating would to the chest has crossed the midline, it is incumbent upon the medical staff to actively exclude injuries to mediastinal structures such as the heart, aortic arch, bronchial tree, and esophagus, even though injury to such structures may not be immediately clinically apparent. The successful management of a patient with a gunshot wound apparently traversing the anterior mediastinum is presented; an esophagram identified an unsuspected through-and-through injury to the esophagus. The evaluation of this patient is discussed, and an algorithm for the evaluation and management of similar patients is proposed.

Adult↗