Search PubMed⌕ Search

Biomedical subjects

R A Lazzarini

Publications and source records attributed to R A Lazzarini.

At least 109 records · Page 6Linked to original sources
PubMed1979

Defective interfering particles modulate VSV infection of dissociated neuron cultures.

Infection of dissociated neuron cultures of mice with VSV and its defective particle DI-T was studied using fluorescent light microscopy as well as transmission and scanning electron microscopy. When cultures are infected with wild virus, VSV replicates selectively in neurons, producing cell death within 24-48 hr. Sensory and immature neurons express viral antigen most rapidly. Viral antigen and viral budding sites are detected along the neuron soma and dendrites. When large amounts of DI-T particles are added to the wild virus inoculum, viral growth is completely suppressed in mature neurons, the cell killing effects of VSV are considerably delayed and co-infected cultures survive for 5-16 days. Viral antigen accumulates in cytoplasmic inclusions and on the membrane of neuron cell somas and dendrites in the virtual absence of viral assembly. Identical modulation of VSV infection in mature neuron cultures is obtained when DI-T particles are added before or after the wild virus, but ultraviolet inactivation of DIs completely abolishes their protective effect. Immature neurons or Vero cells cannot be protected from acute cytopathic changes by an equivalent amount of DI particles. Thus DIs interfere with replication and assembly of the wild virus and attenuate cell killing effects in mature neurons in vitro.

Animals↗
PubMed1979

Efficient propagation of measles virus in suspension cultures.

Suspension cultures of a human prostate cell line (MA160) supported abundant growth of the Edmonston strain of measles virus. The virus yields obtained with these suspension cultures (150 to 800 PFU/cell) were at least 20- to 100-fold higher than those frequently reported in the literature. Monolayer cultures of MA160 cells did not support a virus replication nearly as efficiently (progeny yield, 25 PFU/cell).

Cell Line↗
PubMed1979

Terminal sequences of vesicular stomatitis virus RNA are both complementary and conserved.

The nucleotide sequences at the 5' and 3' termini of RNA isolated from the New Jersey serotype of vesicular stomatitis virus [vsV(NJ)] and two of its defective interfering (DI) particles have been determined. The sequence differs from that previously demonstrated for the RNA from the Indiana serotype of VSV at only 1 of the first 17 positions from the 3' terminus and at only 2 of the first 17 positions from the 5' terminus. The 5'-terminal sequence of VSV(NJ) RNA is the complement of the 3'-terminal sequence, and duplexes which are 20 bases long and contain the 3' and 5' termini have been isolated from this RNA. The RNAs isolated from DI particles of VSV(NJ) have the same base sequences as do the RNAs from the parental virus. These results are in sharp contrast to those obtained with the Indiana serotype of VSV and its DI particles, in which the 3'-terminal sequences differ in 3 positions within the first 17. However, with both serotypes, the 3'-terminal sequence of the DI RNA is the complement of the 5'-terminal sequence of the RNA from the infectious virus. These findings suggest that the 3' and 5' RNA termini are highly conserved in both serotypes and that the 3' terminus of DI RNA is ultimately derived by copying the 5' end of the VSV genome, as recently proposed (D. Kolakofsky, M. Leppert, and L. Kort, in B. W. J. Mahy and R. D. Barry, ed., Negative-Strand Virus and the Host Cell, 1977; M. Leppert, L. Kort, and D. Kolakofsky, Cell 12:539-552, 1977; A. S. Huang, Bacteriol. Rev. 41:811-8218 1977).

Animals↗
PubMed1978

Intervening polyadenylate sequences in RNA transcripts of vesicular stomatitis virus.

Purified and partially resolved vesicular stomatitis virus (VSV) messenger RNA has been annealed to the VSV genomic RNA and visualized in the electron microscope under conditions in which duplex regions have a wider image width than single-stranded RNA. The locations of the intercistronic boundaries between the messages have been mapped on the VSV genome. The contour of the double-stranded regions is occasionally interrupted by looped-out single-stranded RNA. The loops are comprised of post transcriptionally synthesized polyadenylate. Most of these structures are found at the intercistronic boundaries and covalently bridge adjacent message sequences. In this paper, we discuss the possible significance of these loops.

Chromosome Mapping↗
PubMed1978

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.

Base Sequence↗
PubMed1978

Nucleotide sequence homology at the 3' termini of RNA from vesicular stomatitis virus and its defective interfering particles.

Vesicular stomatitis virus (VSV) and defective interfering (DI) particle RNAs were labeled at their 3' ends by using RNA ligase and cytidine 3',5'-bis[32P]phosphate. The RNAs were subjected to partial digestion with alkali and analyzed by oligonucleotide fingerprinting in two dimensions. VSV and DI particle RNAs have complete sequence homology for the first eight bases from the 3' end. The following four positions contain three mismatched nucleotides in which guanosine residues in one strand are replaced by uridine residues in the other. There is again complete homology for the next five bases (positions 13-17). The locations of purine residues within the sequence were confirmed by partial digestion with RNase T1 and RNase U2 and separation by size on 20% acrylamide gels. The latter method also indicated that sequences of VSV and DI particle RNAs diverge beyond the 18th nucleotide from the 3' termini.

Base Sequence↗
PubMed1977

Replication of viral RNA by a defective interfering vesicular stomatitis virus particle in the absence of helper virus.

The genome of a defective interfering particle (DILT) derived from the heat-resistant strain of vesicular stomatitis virus is expressed in vivo without the assistance of infectious helper virus. The rates of RNA synthesis in the presence of cycloheximide (primary transcription) are the same when infections are with equal numbers of physical particles of DILT or virus. With this treatment, DILT synthesizes only 12-17S mRNAs as characterized by size, polarity, and polyadenylylation. In the absence of cycloheximide, DILT-infected cells produce not only these mRNAs but also a 28S RNA species. This RNA, which represents one half of the viral specific RNA, contains newly synthesized full-length (+) and (-) strand DILT RNA. Both strands are found intracellularly as ribonucleoprotein complexes. Without cycloheximide present, the rate of RNA synthesis by DILT was less than that by virus. This curtailment is most likely due to the inability of DILT to synthesize L protein mRNA. An expanded role for defective interfering particles in infection is discussed.

Cells, Cultured↗
PubMed1977

In vitro synthesis of messenger RNA by a defective interfering particle of vesicular stomatitis virus.

A defective interfering particle derived from the heat-resistant strain of vesicular stomatitis virus was analyzed for the presence of virion-associated RNA polymerase (nucleosidetriphosphate:RNA nucleotidyltransferase, EC 2.7.7.6) activtiy. The RNA synthesizing capacity of the defective particles in vitro was similar to that of the wild-type virus. Characterization of the RNA produced in vitro indicated that the defective particles were able to synthesize vesicular stomatitis virus leader RNA and four virus mRNA species that sediment at 12-18 S. These RNA products were identical to the mRNAs synthesized in vitro by the wild-type virus in regard to size, polyadenylation, capping, and methylation. In contrast to the wild-type virus, the purified defective particles did not synthesize the large mRNA species sedimenting at 31 S in vitro. Possible mechanisms of homotypic and heterotypic interferences shown by this defective particle are discussed.

Chromosome Mapping↗