Search PubMed⌕ Search

Biomedical subjects

R A Bender

Publications and source records attributed to R A Bender.

At least 37 records · Page 2Linked to original sources
PubMed1994

Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis.

Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left-entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator.

Bacterial Proteins↗
PubMed1993

The nac (nitrogen assimilation control) gene from Klebsiella aerogenes.

The Klebsiella aerogenes nac gene, whose product is necessary for nitrogen regulation of a number of operons, was identified and its DNA sequence determined. The nac sequence predicted a protein a 305 amino acids with a strong similarity to members of the LysR family of regulatory proteins, especially OxyR from Escherichia coli. Analysis of proteins expressed in minicells showed that nac is a single-gene operon whose product has an apparent molecular weight of about 32 kDa as measured in sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Immediately downstream from nac is a two-gene operon, the first gene of which encodes another member of the LysR family. Upstream from nac is a tRNAAsn gene transcribed divergently from nac. About 60 bp upstream from the nac open reading frame lies a sequence nearly identical to the consensus for sigma 54-dependent promoters, with the conserved GG and GC nucleotides at -26 and -14 relative to the start of transcription. About 130 bp farther upstream (at -153 relative to the start of transcription) is a sequence nearly identical to the transcriptional activator NTRC-responsive enhancer consensus. Another weaker NTRC-binding site is located adjacent to this site (at -133 relative to the start of transcription). Thus, we propose that nac is transcribed by RNA polymerase carrying sigma 54 in response to the nitrogen regulatory (NTR) system. A transposon located between the promoter and the nac ORF prevented NTR-mediated expression of nac, supporting this identification of the promoter sequence. The insertion of over 5 kb of transposon DNA between the enhancer and its target promoter had only a weak effect on enhancer-mediated regulation, suggesting that enhancers may be able to act at a considerable distance on the bacterial chromosome.

Amino Acid Sequence↗
PubMed1993

The product of the Klebsiella aerogenes nac (nitrogen assimilation control) gene is sufficient for activation of the hut operons and repression of the gdh operon.

In Klebsiella aerogenes, the formation of a large number of enzymes responds to the quality and quantity of the nitrogen source provided in the growth medium, and this regulation requires the action of the nitrogen regulatory (NTR) system in every case known. Nitrogen regulation of several operons requires not only the NTR system, but also NAC, the product of the nac gene, raising the question of whether the role of NAC is to activate operons directly or by modifying the specificity of the NTR system. We isolated an insertion of the transposon Tn5tac1 which puts nac gene expression under the control of the IPTG-inducible tac promoter rather than the nitrogen-responsive nac promoter. When IPTG was present, cells carrying the tac-nac fusion activated NAC-dependent operons and repressed NAC-repressible operons independent of the nitrogen supply and even in the absence of an active NTR system. Thus, NAC is sufficient to regulate operons like hut (encoding histidase) and gdh (encoding glutamate dehydrogenase), confirming the model that the NTR system activates nac expression and NAC activates hut and represses gdh. Activation of urease formation occurred at a lower level of NAC than that required for glutamate dehydrogenase repression, and activation of histidase formation required still more NAC.

Bacterial Proteins↗
PubMed1991

The role of the NAC protein in the nitrogen regulation of Klebsiella aerogenes.

The NAC (nitrogen assimilation control) protein from Klebsiella aerogenes is a LysR-like regulator for transcription of several operons involved in nitrogen metabolism, and couples the transcription of these sigma 70-dependent operons to regulation by the sigma 54-dependent NTR system. NAC activates expression of operons (e.g. histidine utilization, hut), allowing use of poor nitrogen sources, and represses expression of operons (e.g. glutamate dehydrogenase, gdh) allowing assimilation of the preferred nitrogen source, ammonium. NAC is both necessary and sufficient to activate transcription, but the expression of the nac gene is totally dependent on the central nitrogen regulatory system (NTR) and RNA polymerase carrying the sigma 54 sigma factor (RNAP sigma 54). Nitrogen starvation signals the NTR system to transcribe nac, and NAC activates the transcription of hut, put (proline utilization), and urease. NAC does not affect the transcription of RNAP sigma 54-dependent operons like ginA or nifLA, which respond directly to the NTR system, but activates transcription of RNAP sigma 70-dependent operons. Thus NAC acts as a bridge between RNAP sigma 70-dependent operons like hut and the RNAP sigma 54-dependent NTR system. The activation of operons like hut by NAC in response to nitrogen starvation is at least superficially similar to their activation by CAP-cAMP in response to carbon and energy starvation.

Ammonia↗
PubMed1991

In vitro transcription of the histidine utilization (hutUH) operon from Klebsiella aerogenes.

The promoter region preceding the hutUH operon in Klebsiella aerogenes contains two oppositely oriented, overlapping promoters. In the absence of catabolite gene activator protein-cyclic AMP (CAP-cAMP), transcription proceeds primarily from the backward-oriented promoter (Pc), whose function has not yet been determined, and only very weakly from the forward hutUH promoter, hutUp. In the presence of CAP-cAMP, Pc is repressed and transcription from hutUp is favored. Two protein components required for this in vitro transcription system, RNA polymerase (RNAP) and CAP, were purified from K. aerogenes and were shown to be functionally interchangeable with the corresponding proteins from Escherichia coli, suggesting that E. coli RNAP could be used to study some aspects of hut transcription. We showed that a gradual activation of hutUp (by increasing concentrations of CAP, cAMP, or glycerol) resulted in a parallel repression of Pc, arguing in favor of a direct competition between the two promoters. The presence of a DNA sequence resembling the consensus for CAP-binding sites and centered at nucleotide -82 (relative to hutUp) initially suggested that a primary role of CAP was to repress Pc, thereby indirectly activating hutUp. However, the relatively slow formation of open complexes at Pc, even in the absence of CAP-cAMP, showed that Pc is a weak promoter and likely to be a poor competitor for RNAP. The observed dominance of Pc over hutUp suggested that the latter is an even weaker promoter. Thus, repression of Pc would not be sufficient to cause the observed increase in hutUp activity, and the CAP-cAMP complex must play a direct role in the activation of hutUp.

Base Sequence↗
PubMed1991

Klebsiella aerogenes catabolite gene activator protein and the gene encoding it (crp).

The catabolite gene activator protein from Klebsiella aerogenes (CAPK) and the corresponding protein from Escherichia coli (CAPE) were shown to be nearly identical. Both CAPK and CAPE activated transcription from the CAP-dependent promoters derived from E. coli and K. aerogenes. The crp gene from K. aerogenes (encoding CAP) is tightly linked to rpsL. The nucleotide sequence of crp predicts an amino acid sequence for CAPK that differs in only one position from that of CAPE.

Amino Acid Sequence↗
PubMed1990

Tn1000-mediated insertion mutagenesis of the histidine utilization (hut) gene cluster from Klebsiella aerogenes: genetic analysis of hut and unusual target specificity of Tn1000.

The histidine utilization (hut) genes from Klebsiella aerogenes were cloned in both orientations into the HindIII site of plasmid pBR325, and the two resulting plasmids, pCB120 and pCB121, were subjected to mutagenesis with Tn1000. The insertion sites of Tn1000 into pCB121 were evenly distributed throughout the plasmid, but the insertion sites into pCB120 were not. There was a large excess of Tn1000 insertions in the "plus" or gamma delta orientation in a small, ca. 3.5-kilobase region of the plasmid. Genetic analysis of the Tn1000 insertions in pCB120 and pCB121 showed that the hutUH genes form an operon transcribed from hutU and that the hutC gene (encoding the hut-specific repressor) is independently transcribed from its own promoter. The hutIG cluster appears not to form an operon. Curiously, insertions in hutI gave two different phenotypes in complementation tests against hutG504, suggesting either that hutI contains two functionally distinct domains or that there may be another undefined locus within the hut cluster. The set of Tn1000 insertions allowed an assignment of the gene boundaries within the hut cluster, and minicell analysis of the polypeptides expressed from plasmids carrying insertions in the hut genes showed that the hutI, hutG, hutU, and hutH genes encode polypeptides of 43, 33, 57, and 54 kilodaltons, respectively.

Cloning, Molecular↗
PubMed1990

Cloning of the Klebsiella aerogenes nac gene, which encodes a factor required for nitrogen regulation of the histidine utilization (hut) operons in Salmonella typhimurium.

The nac (nitrogen assimilation control) gene from Klebsiella aerogenes, cloned in a low-copy-number cloning vector, restored the ability of K. aerogenes nac mutants to activate histidase and repress glutamate dehydrogenase formation in response to nitrogen limitation and to limit the maximum expression of the nac promoter. When present in Salmonella typhimurium, the K. aerogenes nac gene allowed the hut genes to be activated during nitrogen-limited growth. Thus, the nac gene encodes a cytoplasmic factor required for activation of hut expression in S. typhimurium during nitrogen-limited growth.

Cloning, Molecular↗
PubMed1990

Role of the nac gene product in the nitrogen regulation of some NTR-regulated operons of Klebsiella aerogenes.

A positive, genetic selection against the activity of the nitrogen regulatory (NTR) system was used to isolate insertion mutations affecting nitrogen regulation in Klebsiella aerogenes. Two classes of mutation were obtained: those affecting the NTR system itself and leading to the loss of almost all nitrogen regulation, and those affecting the nac locus and leading to a loss of nitrogen regulation of a family of nitrogen-regulated enzymes. The set of these nac-dependent enzymes included histidase, glutamate dehydrogenase, glutamate synthase, proline oxidase, and urease. The enzymes shown to be nac independent included glutamine synthetase, asparaginase, tryptophan permease, nitrate reductase, the product of the nifLA operon, and perhaps nitrite reductase. The expression of the nac gene was itself highly nitrogen regulated, and this regulation was mediated by the NTR system. The loss of nitrogen regulation was found in each of the four insertion mutants studied, showing that loss of nitrogen regulation resulted from the absence of nac function rather than from an altered form of the nac gene product. Thus we propose two classes of nitrogen-regulated operons: in class I, the NTR system directly activates expression of the operon; in class II, the NTR system activates nac expression and the product(s) of the nac locus activates expression of the operon.

Amino Acid Transport Systems↗
PubMed1990

Regulation of assimilatory nitrate reductase formation in Klebsiella aerogenes W70.

Klebsiella aerogenes W70 could grow aerobically with nitrate or nitrite as the sole nitrogen source. The assimilatory nitrate reductase and nitrite reductase responsible for this ability required the presence of either nitrate or nitrite as an inducer, and both enzymes were repressed by ammonia. The repression by ammonia, which required the NTR (nitrogen regulatory) system (A. Macaluso, E. A. Best, and R. A. Bender, J. Bacteriol. 172:7249-7255, 1990), did not act solely at the level of inducer exclusion, since strains in which the expression of assimilatory nitrate reductase and nitrite reductase was was independent of the inducer were also susceptible to repression by ammonia. Insertion mutations in two distinct genes, neither of which affected the NTR system, resulted in the loss of both assimilatory nitrate reductase and nitrite reductase. One of these mutants reverted to the wild type, but the other yielded pseudorevertants at high frequency that were independent of inducer but still responded to ammonia repression.

Ammonia↗
PubMed1990

Nucleotide sequence of the gene encoding the repressor for the histidine utilization genes of Klebsiella aerogenes.

The hutC gene of Klebsiella aerogenes encodes a repressor that regulates expression of the histidine utilization (hut) operons. The DNA sequence of a region known to contain hutC was determined and shown to contain two long rightward-reading open reading frames (ORFs). One of these ORFs was identified as the 3' portion of the hutG gene. The other ORF was the hutC gene. The repressor predicted from the hutC sequence contained a helix-turn-helix motif strongly similar to that seen in other DNA-binding proteins, such as lac repressor and the catabolite gene activator protein. This motif was located in the N-terminal portion of the protein, and this portion of the protein seemed to be sufficient to allow repression of the hutUH operon but insufficient to allow interaction with the inducer. The presence of a promoterlike sequence and a ribosome-binding site immediately upstream of the hutC gene explained the earlier observation that hutC can be transcribed independently of the other hut operon genes. The predicted amino acid sequence of hut repressor strongly resembled that of the corresponding protein from Pseudomonas putida (S. L. Allison and A. T. Phillips, J. Bacteriol. 172:5470-5476, 1990). An unexpected, leftward-reading ORF extending from about the middle of hutC into the preceding (hutG) gene was also detected. The deduced amino acid sequence of this leftward ORF was quite distinct from that of an unexpected ORF of similar size found immediately downstream of the P. putida hutC gene. The nonstandard codon usage of this leftward ORF and the expression of repressor activity from plasmids with deletions in this region made it unlikely that this ORF was necessary for repressor activity.

Amino Acid Sequence↗
PubMed1989

Cyclophosphamide therapy of idiopathic hepatic granulomatosis.

A 50-year-old woman presented with idiopathic hepatic granulomatosis and autoimmune hemolytic anemia. Splenectomy corrected the anemia, and the liver disorder responded to prednisone. However, her liver disease relapsed on four occasions when prednisone was tapered, including three episodes when hepatic granulomatosis was proven by biopsy. Cyclophosphamide therapy allowed prednisone withdrawal, and she has remained in clinical and biochemical remission for two years on a low dose of the drug.

Anemia, Hemolytic, Autoimmune↗
PubMed1989

Role of the flagellum in cell-cycle-dependent expression of bacteriophage receptor activity in Caulobacter crescentus.

The rate of adsorption of Caulobacter bacteriophage phi CbK to Caulobacter crescentus is dependent on the structural integrity of the flagellum. Cells lacking part or all of the flagellum because of either mutation or mechanical shear were defective in adsorption, and the extent of the defect in adsorption reflected the amount of flagellar structure missing. Maximal adsorption rates were also dependent on cellular motility and energy metabolism, since adsorption to cells with paralyzed flagella was slower than adsorption to motile cells and inhibition of cellular energy metabolism with azide also reduced adsorption rates, even for nonmotile cells. Nevertheless, the flagellum is not the receptor for phage phi CbK, since flagellumless mutants adsorbed phi CbK at detectable rates. While some portion of the fluctuation in the phi CbK receptor activity during the C. crescentus cell cycle can be ascribed to the periodicity of flagellar loss and reappearance, the phage receptor activity remaining in flagellumless mutants was periodic in the cell cycle. Therefore, the periodic expression of phage receptor activity is an intrinsic property of the C. crescentus cell cycle, although the amplitude of the oscillation may be altered by the periodic expression of flagellar motility.

Bacteria↗
PubMed1989

An rpoN-like gene of Alcaligenes eutrophus and Pseudomonas facilis controls expression of diverse metabolic pathways, including hydrogen oxidation.

Pleiotropic mutants of Alcaligenes eutrophus with the phenotype Hno- have been characterized previously. They are deficient in several diverse metabolic activities, including hydrogen oxidation, nitrate and urea assimilation, denitrification, and various substrate transport systems. Phenotypically similar mutants were identified among hydrogenase-deficient strains of Pseudomonas facilis. The Tn5-labeled hno gene was cloned from a genomic DNA library of A. eutrophus and used to identify the corresponding unimpaired wild-type DNA sequence. The recombinant plasmid pCH148 contained an insert of 12.3 kilobase pairs and was shown to restore the Hno+ phenotype to mutants of A. eutrophus and P. facilis. A cosmid isolated from a DNA library of P. facilis also exhibited intergeneric Hno-complementing activity. The cloned hno loci from both organisms showed DNA homology by Southern blot hybridization. A subclone of pCH148 which contained a 6.5-kilobase-pair insert was constructed. The resulting hybrid, pCH170, not only was able to complement Hno- mutants but also relieved glutamine auxotrophy in NtrA- mutants of enteric bacteria. This suggests that the hno gene product from A. eutrophus is functionally similar to the NtrA protein, which has been identified as a novel sigma factor (sigma 54) of RNA polymerase.

Alcaligenes↗
PubMed1989

Cell-cycle-dependent polar morphogenesis in Caulobacter crescentus: roles of phospholipid, DNA, and protein syntheses.

During swarmer cell differentiation in Caulobacter crescentus, morphogenesis at the swarmer pole is characterized by the loss of the flagellum, by the loss of phage receptor activity (PRA) (the ability of the cell to adsorb phage phi CbK), and finally by the initiation of stalk outgrowth at the site formerly occupied by the flagellum and the PRA. We show here that each of these events is a cell cycle-dependent event requiring continuous protein synthesis for its execution but occurring normally in the absence of DNA synthesis or phospholipid synthesis. During stalked-cell differentiation, the flagellum and PRA reappear and the stalk elongates considerably. We show here that these events are also cell cycle dependent, requiring not only de novo protein synthesis but also DNA and phospholipid syntheses. When synchronous cells dividing 160 min after collection were used, PRA reappearance occurred at 110 min. This PRA reappearance was dependent on a phospholipid synthesis-requiring event occurring at 70 min, a DNA synthesis-requiring event occurring at 95 min, and a protein synthesis-requiring event occurring at 108 min. In the absence of net phospholipid synthesis, stalk elongation appeared more or less normal, but the stalks eventually became fragile, and by 240 min, most of the stalks had broken off, leaving only stubs attached to the cell body.

Bacteria↗
PubMed1988

RNA polymerase as a repressor of transcription in the hut(P) region of mutant Klebsiella aerogenes histidine utilization operons.

Mutants of Klebsiella aerogenes able to express the hutUH operon in the absence of positive effectors were isolated and characterized. These mutations improve the hutUH promoter (PUH) by changing the -10 region to match the consensus sequence more closely. These mutations also affect another, oppositely oriented promoter in this region, PC. Although the mutations lie far outside PC, they cause PC to be inactive, apparently because binding of RNA polymerase to the PUH promoter blocks the overlapping PC site. Thus, in the mutants, RNA polymerase bound at the strong (mutant) PUH site effectively repress the PC promoter.

Chromosome Mapping↗
PubMed1988

Regulation of the galactose-inducible lac operon and the histidine utilization operons in pts mutants of Klebsiella aerogenes.

Galactose appears to be the physiological inducer of the chromosomal lac operon in Klebsiella aerogenes. Both lactose and galactose are poor inducers in strains having a functional galactose catabolism (gal) operon, but both are excellent inducers in gal mutants. Thus the slow growth of K. aerogenes on lactose reflects the rapid degradation of the inducer. Several pts mutations were characterized and shown to affect both inducer exclusion and permanent catabolite repression. The beta-galactosidase of pts mutants cannot be induced at all by lactose, and pts mutants appear to have a permanent and constitutive inducer exclusion phenotype. In addition, pts mutants show a reduced rate of glucose metabolism, leading to slower growth on glucose and a reduced degree of glucose-mediated permanent catabolite repression. The crr-type pseudorevertants of pts mutations relieve the constitutive inducer exclusion for lac but do not restore the full level of glucose-mediated permanent catabolite repression and only slightly weaken the glucose-mediated inducer exclusion. Except for weakening the glucose-mediated permanent catabolite repression, pts and crr mutations have no effect on expression of the histidine utilization (hut) operons.

Ammonia-Lyases↗