Biomedical subjects

Q Zhu

Publications and source records attributed to Q Zhu.

At least 73 records · Page 4Linked to original sources

PubMed2001

Cytoplasmic expression of ribozyme in zebrafish using a T7 autogene system.

A cytoplasmic ribozyme expression system, based on codelivery of a ribozyme vector, a T7 autogene vector, and T7 RNA polymerase (RNAP), has been developed and used to generate a specific phenotype in zebrafish by targeting a no tail (ntl) mRNA. The expression of the no tail ribozyme sequence is under the control of a tandem of two promoters: The T7 promoter and an adenoviral va 1 (pol III) promoter. The coinjection of the ribozyme vector pT7vaRz, the T7 autogene vector pT7T7, and the T7 RNAP resulted in rapid synthesis of the ribozyme against the ntl mRNA in the cytoplasm of the injected zebrafish embryos, generating no tail phenotypes in up to 10-20% of the injected embryos. The phenotypic change rates have been found to be related to the concentrations of the plasmid vectors and T7 RNAP injected and to the ratios of the three injected components. This cytoplasmic ribozyme expression system may be useful for efficiently targeting other mRNA and for various biomedical applications. These potential applications may include rapid identification of biological functions of novel genes from zebrafish and humans based on partial gene sequence information and gene therapy of genetic and acquired diseases.

Adenoviridae↗

PubMed2001

Role of ovarian hormones in the pathogenesis of impaired detrusor contractility: evidence in ovariectomized rodents.

PURPOSE: Although detrusor hyperactivity with impaired contractility is a common urodynamic finding in elderly subjects, to our knowledge its pathogenesis remains unknown. Biopsy studies indicate that subjects with detrusor hyperactivity and impaired contractility have ultrastructural evidence of dysjunction and degeneration patterns in isolated detrusor hyperactivity and impaired contractility, respectively. Based on the known cellular effects of estrogen we postulated that declines in ovarian hormone production may contribute to the pathogenesis of detrusor hyperactivity with impaired contractility. MATERIALS AND METHODS: Mature 13 to 14-month-old female Fisher 344 rats were studied 4 months after bilateral ovariectomy or sham surgery. Detrusor structure was evaluated by electron microscopy and contractility was evaluated by muscle strip studies. RESULTS: After bilateral ovariectomy detrusor smooth muscle decreased by 25% with a 12% decrease in the number of nucleated muscle profiles and degenerative changes in many axons. Muscle strips from bilaterally ovariectomized animals generated 40% to 50% less tension per strip in response to carbachol than strips of equal size from sham operated animals with no apparent change in muscarinic receptor affinity. CONCLUSIONS: Bilateral ovariectomy resulted in many changes of the degeneration ultrastructural pattern but in none of the characteristic features of the dysjunction pattern. Our results indicate that the mature rodent detrusor and its innervation are sensitive to prolonged ovarian hormonal deficiency, contributing to impaired contractility in rodents. Future studies are required to establish whether estrogen has a role in the degeneration ultrastructural pattern or impaired contractility in humans.

Animals↗

PubMed2001

A novel pathway for lipid biosynthesis: the direct acylation of glycerol.

The acylation of glycerol-3-phosphate by acyl-CoA is regarded as the first committed step for the synthesis of the lipoidal moiety in glycerolipids. The direct acylation of glycerol in mammalian tissues has not been demonstrated. In this study, lipid biosynthesis in myoblasts and hepatocytes was reassessed by conducting pulse-chase experiments with [1,3-(3)H]glycerol. The results demonstrated that a portion of labeled glycerol was directly acylated to form monoacylglycerol and, subsequently, diacylglycerol and triacylglycerol. The direct acylation of glycerol became more prominent when the glycerol-3-phosphate pathway was attenuated or when exogenous glycerol levels became elevated. Glycerol:acyl-CoA acyltransferase activity, which is responsible for the direct acylation of glycerol, was detected in the microsomal fraction of heart, liver, kidney, skeletal muscle, and brain tissues. The enzyme from pig heart microsomes displayed optimal activity at pH 6.0 and the preference for arachidonyl-CoA as the acyl donor. The apparent K(m) values for glycerol and arachidonyl-CoA were 1.1 mM and 0.17 mM, respectively. The present study demonstrates the existence of a novel lipid biosynthetic pathway that may be important during hyperglycerolemia produced in diabetes or other pathological conditions.

Acyl Coenzyme A↗

PubMed2001

[Relationship between decline disease of exotic pines(Pinus taeda and P. eliottii) and forest stand and environmental factors].

The relationship between decline disease of exotic pines(Pinus taeda and P. eliottii) plantations in Anhui Province and forest stand status and environmental factors was quantitatively analyzed. Among 18 variable factors from 4 types of factors(climate, soil, stand status, and other diseases and insect pests), 10 factors contributed greatly to the state of illness. These were tree age, stand density, resin-tapping, rainfall, temperature, clay soil, stone soil, soil depth, water-logging, and other diseases and insect pests. Of them soil depth and rainfall negatively, and others positively related with the severity of disease. Accordingly, a linear multiple regression model was derived, which might predict the developmental level of decline disease at any given conditions of exotic pine plantation. In addition, the spiral chart of decline disease was mapped based on the action size and time order of various nosogenetic factors during the incidence of decline disease, which was used to visually describe and quantitatively analyze the disease with complicated causes.

Causality↗

PubMed2001

Hepatitis B virus S gene mutants in infants infected despite immunoprophylaxis.

OBJECTIVE: To assess the correlation between hepatitis B virus (HBV) surface gene mutant infection and hepatitis B (HB) vaccination failure. METHODS: Using sera from 106 infants who were born to HBV carrier mothers and failed in HB immunoprophylaxis, HBV S gene was amplified by PCR, transferred to nylon membranes for Southern blots, and then hybridized with oligonucleotide probes. Eleven of non-hybridizing samples were used for DNA sequencing. RESULTS: 93.4% (99/106) of the samples were HBV DNA positive, and 30.3% (30/99) failed to hybridize with at least one of the four probes. DNA sequencing confirmed that 10 of the 11 samples had an S gene mutation with amino acid (aa) change. The identified mutants included nucleotide (nt) 546T-->A (aa131N-->T), nt531T-->C (aa1261-->T), nt491A-->C (aa113T-->P), nt491T-->A (aa113S-->T), nt533C-->A (aa127P-->T), nt581T-->A (aa143S-->T), nt636A-->T (aa161Y-->F), and nt679A-->C (aa175L-->F). The sequence in one mother-infant pair was completely the same, with mutations at aa131 and aa161. CONCLUSIONS: The prevalence of HBV surface mutants is about 30% in the children failing in HB vaccination. HBV mutants can infect infants by maternal-infant transmission.

DNA, Viral↗

PubMed2001

[Expression of transforming growth factor-beta 1 mRNA during mouse molar morphogenesis].

OBJECTIVE: To investigate the temporal and spatial expression and localization of transforming growth factor-beta 1 mRNA during mouse molar morphogenesis. METHODS: The distribution pattern of TGF-beta 1 mRNA was analysed on 5 microns serial sections of paraformaldehyde-fixed and paraffin-embedded embryonic mouse heads or mandibles using in situ hybridization. RESULTS: The results show that TGF-beta 1 mRNA was expressed during mouse molar morphogenesis in a temporally and spatially regulated fashion. Local expression of TGF-beta 1 mRNA in the dental epithelium at bud-staged (E13) and cap-staged (E15) teeth were observed. During bell stage (E16-18), TGF-beta 1 mRNA was very abundant in the ameloblast layer and dental papilla cells. The expression of TGF-beta 1 was increased in the layer of odontoblast and ameloblast with the differentiation of these cells. CONCLUSIONS: These results suggest that TGF-beta 1 may have an important role in tooth morphogenesis, and TGF-beta 1 acts as a paracrine and autoinducing factor.

Animals↗

PubMed2001

The role of radiocarpal injection arthrography and magnetic resonance imaging in the diagnosis of triangular fibrocartilage complex injuries.

OBJECTIVE: To investigate the radiocarpal joint injection arthrography and magnetic resonance imaging for diagnosis of the triangular fibrocartilage complex (TFCC) injuries. METHODS: Thirteen cases whose main complaints were ulnar wrist pain were given radiocarpal joint arthrography and eight of them were also given magnetic resonance imaging for evaluating the integrity of the triangular fibrocartilage complex. RESULTS: Ten of thirteen cases presented the leakage of contrast medium to distal radioulnar joint from the radiocarpal joint, in whom, 8 were demonstrated triangular fibrocartilage tear on magnetic resonance imaging, and 3 located at radial side, 2 at central, 3 at ulnar side. One of three cases which were demonstrated without the leakage of contrast medium in arthrography were displayed with marked TFCC tear on magnetic resonance imaging. CONCLUSIONS: The wrist arthrography can provide a definite diagnosis for triangular fibrocartilage disruption with higher sensitivity. magnetic resonance imaging not only demonstrates the site of triangular fibrocartilage disruption as the same value as wrist arthrography, but also displays the other related bony and soft tissues changes.

Adult↗

PubMed2001

[Correlation between nutrient levels of vitamin A and zinc and HOX C4 gene expression in mice embryos].

OBJECTIVE: Correlation between nutrient levels of vitamin A and zinc and HOX C4 (3.5) gene expression in mice embryos was studied. METHODS: The Kunming female mice were divided three groups: deficient group (DG) fed with fodder deficient of vitamin A and zinc, replenished group (RG) fed with fodder deficient of vitamin A and zinc until the 7th day after conception and then fed with fodder rich in vitamin A and zinc, and normal group (NG), fed with normal fodder. After obvious symptoms of vitamin A and zinc deficiency appeared, the mice were mated. On the 12th day after conception, pregnant mice were killed and their levels of vitamin A and zinc were determined and the content of mRNA of HOX C4 (3.5) were determined for the embryos with situ hybridization. RESULTS: The level of vitamin A was 0.44 mumol/L, 1.03 mumol/L and 1.40 mumol/L, respectively and that of zinc 124.3 mg/kg, 152.1 mg/kg and 193.8 mg/kg in DG, RG and NG, respectively. The mRNA of HOX C4 (3.5) gene expression in mouse embryos increased significantly in DG, RG and NG (P < 0.05). CONCLUSIONS: Levels of vitamin A and zinc in the body of pregnant mice positively correlated significantly with their HOX C4 (3.5) gene expression, with coefficients of correlation of 0.78 to 0.99.

Animal Nutritional Physiological Phenomena↗

PubMed2001

[Effect of zinc deficiency and zinc replenishment on HOX3.5 gene expression in mouse embryos].

The effect of zinc deficiency and zinc replenishment on HOX3.5 gene expression in mouse embryos was investigated. Sixty Kunming female mice (25-30 g) were divided into three groups: zinc-deficient groups (ZD), zinc-replenished group (ZR) and zinc normal controlled group (ZN). ZD mice fed with ZD diet (Zn 3.0 +/- 0.5 mg/kg), ZN mice fed with ZN diet (Zn 30 mg/kg), and ZR mice fed with ZD diet at first and then with ZN diet from the 7th day of pregnancy. After feeding different diet for 25 days, the mice were made to copulate (female: male = 2:1). At the 12th day of pregnancy, the mice were killed and the embryos were stored at -70 degrees C. The content of mRNA of HOX3.5 in the embryos were determined by in situ hybridization with digxigenin-labeled cDNA probes. The result showed that the expression on area density and L-density (average optical density) of Hox3.5 in ZD and ZR groups were decreased in comparing with those in ZN group (P < 0.05). It was suggested that the decreased HOX3.5 gene expression by zinc deficiency might influence the normal growth of mouse embryos, and this effect might occurr in the early stage of embryo development, which can not be prevented by replenishing zinc at the 7th day of pregnancy.

Animals↗

PubMed2001

[Effect of alcohol extract of Cornus officinalis Sieb. et Zucc on GLUT4 expression in skeletal muscle in type 2 (non-insulin-dependent) diabetic mellitus rats].

OBJECTIVE: Based on its effects of decreasing postprandial plasma glucose and increasing insulin level in non-insulin-dependent diabetic mellitus (NIDDM) rats, we studied the effects of Alcohol extract of Cornus officinalis Sieb. et Zucc on the GLUT4 expression in NIDDM model rats. METHOD: The rat model of NIDDM was made. The animals were divided into three groups(six for each group): group I: control; group II: NIDDM model; group III: NIDDM model + Cornus officinalis Sieb. et Zucc. The drug was given orally to animals one time a day, uninterrupted for a month. The GLUT4 mRNA and its protein expression in skeletal muscle were observed with Northern blot and Western blot method, respectively. RESULT: The GLUT4 mRNA expression in skeletal muscle was decreased remarkably in NIDDM rats (P < 0.01, compared to control group). Alcohol extract of Cornus officinalis Sieb. et Zucc increased GLUT4 mRNA expression in NIDDM rats(P < 0.01), compared to NIDDM model group). The result of GLUT4 protein expression was similar to GLUT4 mRNA expression. CONCLUSION: This experiment demonstrated that alcohol extract of Cornus officinalis Sieb. et Zucc can increase GLUT4 mRNA and its protein expression in NIDDM rats through promoting proliferation of islet and increasing postprandial secretion of insulin and therefore accelerate glucose transport.

Animals↗

PubMed2000

Electrophysiological properties of axons in mice lacking neurofilament subunit genes: disparity between conduction velocity and axon diameter in absence of NF-H.

Neurofilament proteins (NFs) are made by co-polymerization of three intermediate filament proteins, NF-L, NF-M and NF-H and constitute the most abundant cytoskeletal element in large myelinated axons. NFs have a well-established role as intrinsic determinants of axon caliber with all the functional implications, but the role of each individual NF subunit is much less clear. The aim of our study was to examine functional properties of large myelinated axons with altered morphology from mice bearing a targeted disruption of each NF genes (NF-L -/-, NF-M-/- and NF-H -/- mice). Membrane properties, action potentials and single axon refractory period were measured in isolated sciatic nerves in vitro, using intra-axonal microelectrode recording in conjunction with current-clamp technique. Some results were obtained from whole nerves by sucrose-gap recording. The NF-knockout mice showed several deficits in physiological properties of low-threshold fibers. In keeping with smaller axon diameter, the conduction velocity was significantly decreased in NF-L -/- and NF-M -/- transgenic animals (control, 39.9+/-1.8 m/s, NF-M -/-; 23.5+/-1. 4 m/s, and NF-L-/-; 12.0+/-0.7 m/s, mean+/-S.E.M.; intra-axonal recording; similar ratios obtained by sucrose-gap recording; 22-26 degrees C). However, in spite of their preserved caliber, large myelinated axons in NF-H -/- mice also showed a significant decrease in conduction velocity (22.8+/-1.0 m/s, mean+/-S.E.M.). Although action potential amplitudes, duration and shape did not differ between control axons and transgenic animals, the refractory period was prolonged in NF-H -/- and NF-M -/- animals. Intracellular injections of 200 ms depolarizing and hyperpolarizing currents revealed outward and inward rectification in all animal groups. In comparison to control animals, NF-H -/- mice expressed a significant decrease in outward rectification. Potassium channel blockers (4AP and TEA) and cesium ions were able to block outward and inward rectification in all myelinated axons in qualitatively the same manner. These results suggest that NF-H may have a specific role in modulating ion channel functions in large myelinated fibers.

Action Potentials↗

PubMed2000

Inhibition of the mammalian transcription factor LSF induces S-phase-dependent apoptosis by downregulating thymidylate synthase expression.

The thymidylate synthase (TS) gene, which is induced at the G(1)-S transition in growth-stimulated cells, encodes an enzyme that is essential for DNA replication and cell survival. Here we demonstrate that LSF (LBP-1c, CP2) binds to sites within the TS promoter and intronic regions that are required for this induction. Mutation of the LSF binding sites inhibits G(1)-S induction of mRNA derived from a TS minigene. Furthermore, expression of dominant-negative LSF (LSFdn) prevents the increase in TS enzyme levels during G(1)-S, and induces apoptosis in growth- stimulated mouse and human cell lines. Such apoptosis can be prevented either by circumventing the TS requirement through addition of low concentrations of thymidine, or by coexpression of the TS gene driven by a heterologous promoter. Induction of apoptosis by LSFdn parallels the process known as thymineless death, which is induced by the TS inhibitor and chemotherapeutic drug 5-fluorodeoxyuridine. Thus, LSF is a novel regulatory factor that supports progression through S-phase by targeting a single gene that is critical for cell survival.

Amino Acid Sequence↗

PubMed2000

Perception of brassinosteroids by the extracellular domain of the receptor kinase BRI1.

An assay was developed to study plant receptor kinase activation and signaling mechanisms. The extracellular leucine-rich repeat (LRR) and transmembrane domains of the Arabidopsis receptor kinase BRI1, which is implicated in brassinosteroid signaling, were fused to the serine/threonine kinase domain of XA21, the rice disease resistance receptor. The chimeric receptor initiates plant defense responses in rice cells upon treatment with brassinosteroids. These results, which indicate that the extracellular domain of BRI1 perceives brassinosteroids, suggest a general signaling mechanism for the LRR receptor kinases of plants. This system should allow the discovery of ligands for the LRR kinases, the largest group of plant receptor kinases.

Arabidopsis↗

PubMed2000

Genetically modified dendritic cells prime autoreactive T cells through a pathway independent of CD40L and interleukin 12: implications for cancer vaccines.

Genetic immunization through ex vivo transduction of dendritic cells has been suggested as an effective approach to enhance antitumor immunity by activating both CD4+ and CD8+ T cells. Immunizing mice with dendritic cells transduced with an adenovirus expressing the human melanoma antigen glycoprotein 100 (DCAdhgp100) as a cancer vaccine, we demonstrated complete protective immunity and a potent CTL response against melanomas expressing murine glycoprotein 100 in a CD4+ cell-dependent manner. Surprisingly, however, effective tumor rejection was not the result of cooperation between CD4+ and CD8+ T cells. Protective immunity was completely lost when CD4+ cells were depleted immediately before tumor challenge, whereas it was unaffected by removal of CD8+ cells, establishing a principal role for CD4+ cells in the effector phase of tumor rejection. Neither protective immunity nor CTL generation in this model required interleukin 12, in spite of high levels of IFN-gamma secretion by tumor-reactive T cells. Most notably, the DCAdhgp100 vaccine could elicit protective antitumor CD4+ cells in the absence of CD40 ligand, although it does not bypass the need for CD40-mediated signals to generate melanoma-reactive CTLs. Thus, in contrast to the current thinking that the optimal cancer vaccine should include determinants for both CD4+ and CD8+ cells, the potency of the DCAdhgp100 vaccine appears to be a result of its ability to directly prime autoreactive CD4+ cells through a process that does not require interleukin 12 and CD40 signals.

Adenoviridae↗

PubMed2000

Observations on the muscles of the eye of the bowhead whale, Balaena mysticetus.

The muscles of the eyelids and the extraocular muscles of mysticete whales are poorly described for a variety of reasons, including considerable difficulty in obtaining specimens. Our objective is to provide such a description for the bowhead whale, Balaena mysticetus. This study has examined the gross anatomy of the region in six specimens (five adults, one fetus) of the bowhead whale. Results show that the muscles associated with the eye are well developed and possess several distinctive features. For example, precise limits of each extraocular muscle are difficult to determine along their entire length because these muscles intermingle with one another near their insertion. Furthermore, some fibers from these muscles (except the retractor bulbi) also insert into the eyelids. Pulling on these muscles to simulate contraction results in movement of the eyelids and suggests a role for these muscles in palpebral retraction. Insertion of a large levator palpebrae superioris muscle into the upper eyelid further enhances opening of the palpebral fissure. Another unusual feature is the presence of tunnel-like structures that redirect the dorsal and ventral oblique muscles. The dorsal oblique muscle is redirected caudally about 90 degrees, then directed medially by another 90 degrees. These directional changes are accomplished via a connective tissue tunnel derived in part from the fibrous connective tissue of the dorsal rectus and the levator palpebrae superioris muscles. In most terrestrial mammals, a similar change in direction is accomplished by a cartilaginous trochlea. The ventral oblique muscle originates via a slender tendon from the frontal bone and undergoes a similar radical change in direction. Its tendon of insertion undergoes about a 90-degree change in direction that is accomplished through a tunnel-like structure derived from fibrous connective tissue of the ventral rectus muscle. Based on the morphology of the musculature presented, it is likely that the eyeballs and eyelids of the bowhead whale are quite mobile and appear capable of complex movement. The possibility of retraction and protrusion of the eyeball is discussed.

Age Factors↗

PubMed2000

[Effects of vitamin A on Hox 3.5 gene expression in mouse embryo].

In order to investigate the effects of vitamin A(VA) deficiency and VA supplementation on Hox 3.5 gene expression in mouse embryo, 60 Kunming weaning female mice were divided into four groups. The normal control group (N) was fed diet containing VA 4,000 IU/kg. The other 3 groups were fed VA deficient diet (VA 0 IU/kg diet) for 16 weeks and then make all mice mating with normal male mice. Group A was fed VA deficient diet all through the experiment. Group B and group C were fed diet supplemented with VA (VA 10,000 IU/kg) from the day zero and from the 7th day after conception respectively. On the 12th day of gestation, 6 pregnant mice in each group were killed and the embryos were taken immediately. In situ hybridization was used to determine the contents of mRNA of Hox 3.5 gene in mice embryos by digoxin-labeled cDNA probes. The results revealed that the contents of Hox 3.5 gene mRNA in the embryos of group A and C decreased significantly compared from group N and B, and that in group B had no difference from group N. The mRNA contents of group C were higher compared with group A, but still was lower than that of group N. It was concluded that vitamin A might influence the development of embryos by regulating the expression of homeobox gene.

Animals↗

PubMed2000

The effects of cyclic loading on pull-out strength of sacral screw fixation: an in vitro biomechanical study.

STUDY DESIGN: The pull-out strength of sacral screw fixation after cyclic loading was tested using young human cadaveric specimens. OBJECTIVES: To evaluate the effects of fatigue loading on the pull-out strength of medial and lateral unicortical and bicortical sacral screws and to correlate the pull-out strength with sacral bone density and the screw insertion torque. SUMMARY OF BACKGROUND DATA: The immediate biomechanical effects of depth of penetration, screw orientation, and bone density on sacral screw fixation have been studied in aged cadaveric specimens. The effect of cyclic loading on the pull-out strength of sacral screw fixation is unknown, however, and data from young specimens is rare. METHODS: Eleven fresh specimens of human sacrum were used in this study. Bone mineral density at the vertebral body and the ala were determined by peripheral quantitative computed tomography. Seven-millimeter compact Cotrel-Dubousset sacral screws were inserted into the sacrum anteromedially and anterolaterally, both unicortically and bicortically, and the insertion torque for each screw was measured. Cyclic loading from 40 to 400 N was applied to each screw at a frequency of 2 Hz up to 20,000 cycles. Pull-out tests were conducted after completion of the fatigue tests. RESULTS: The average bone density was 0.38 +/- 0.08 g/mL at the S1 body and 0.24 +/- 0.05 g/mL at the S1 ala. The insertion torque and average pull-out force after cyclic loading were significantly higher for bicortical fixation than for unicortical fixation for a particular screw alignment. The pull-out strength and insertion torque of medially oriented fixation was always higher than that for lateral fixation, however, regardless of whether the insertion was unicortical or bicortical. The pull-out force of unicortical and bicortical medial screw fixations after cyclic loading showed significant linear correlations with both the insertion torque and the bone mineral density of the S1 body. CONCLUSIONS: In a young population, screw orientation (anterolateral or anteromedial) was more important in determining pull-out strength than screw depth (unicortical or bicortical) after fatigue loading, anteromedially directed screws being significantly stronger than laterallyplaced screws. Bone mineral density of the S1 body andinsertion torque were good preoperative and intraoperative indicators of screw pull-out strength.

Adult↗

PubMed2000

An SP1-like cis-element is the major DNA motif for differential expression regulation of the adipocyte amino acid transporter.

Adipocyte amino acid transporter (AAAT) is induced during the 3T3-L1 preadipocyte differentiation process. In the -1819-bp 5'-upstream flanking region of the AAAT genomic gene, six DNase I protected sites were identified by using the 3T3-L1 adipocyte nuclear extract. Results of chloramphenicol acetyltransferase (CAT) expression from the chimeric AAAT promoter-driven CAT reporter gene indicated that one protein binding site, from -68 to -26, was essential for the promoter activity. However, this protein binding site does not contain recognition sites of the transcription factors important for adipocyte differentiation, i.e., the C/EBP or PPAR family. Further analysis revealed that the DNA sequence, TTCAAGTCCCGCCCTCCGCT from -65 to -46, was the cis-element essential and partially sufficient for inducible activity of the AAAT gene promoter.

3T3 Cells↗