Search PubMed⌕ Search

Biomedical subjects

Ping Ma

Publications and source records attributed to Ping Ma.

18 recordsLinked to original sources

The 13-lipoxygenase GmLOX6 is involved in JA biosynthesis and serves as a positive regulator of salt stress tolerance in soybean.

Salinity represents a major abiotic stressor that significantly impairs soybean growth and yield. Although jasmonic acid (JA) has been firmly established as a key regulator of plant defense against salt stress, the precise functions of lipoxygenase (LOX) genes responsible for initiating JA biosynthesis remain poorly defined. Here, a comprehensive genome-wide analysis of the soybean LOX gene family was performed, and a detailed functional characterization of GmLOX6 was carried out. Subcellular localization confirmed that GmLOX6 is targeted to chloroplasts, while enzymatic assays demonstrated that it acts as a 13-LOX enzyme with a strong preference for α-linolenic acid as substrate. To clarify its role under salt stress, we generated both overexpression and CRISPR/Cas9-mediated knockout lines of soybean. Phenotypic and molecular evaluations revealed that GmLOX6 facilitates JA production under salt stress, thereby contributing to enhanced JA accumulation. This elevation in JA levels was associated with improved salt tolerance through multiple physiological adaptations, including the activation of antioxidant enzymes for the detoxification of reactive oxygen species (ROS), enhanced Na+ extrusion to preserve ionic balance, and reinforced membrane stability. Moreover, GmRWP-RK11 was identified as a transcriptional repressor of GmLOX6. Functional disruption of GmRWP-RK11 via CRISPR/Cas9 conferred greater salt tolerance, further supporting its negative regulatory role. Collectively, these findings uncover a novel regulatory axis in which GmLOX6-mediated JA biosynthesis enhances soybean resistance to salinity through modulation of ROS homeostasis and Na+ transport. These insights provide an expanded understanding of the transcriptional and biochemical mechanisms underpinning JA-driven stress adaptation in soybean.

Glycine max↗

Expression of protein kinase C isoforms in cultured human retinal pigment epithelial cells.

BACKGROUND: Protein kinase C (PKC) is involved in both physiological and pathophysiological processes and plays an important role in signal transduction. The present studies were designed to examine the 12 isoforms (PKCalpha, PKCbetaI, PKCbetaII, PKCgamma, PKCdelta, PKCepsilon, PKCeta, PKCtheta, PKCmu, PKCxi, PKClambda and PKCiota) of PKC expressed in cultured human retinal pigment epithelium (RPE) cells. METHODS: Human RPE cells were investigated for 12 PKC isoforms at the mRNA, protein and cellular levels by reverse transcription (RT)-PCR, Western blot analysis and laser scanning confocal microscope (LSCM), respectively. RESULTS: RT-PCR and Western blot analyses showed similar results for specific PKC isoforms in that both revealed that PKCalpha, PKCbetaI, PKCbetaII, PKCdelta, PKCepsilon, PKCtheta, PKCmu, PKCxi, PKClambda and PKCiota, but not PKCgamma and PKCeta, were constantly expressed in RPE cells, with the exception of PKCbetaI at the protein level. Confocal microscopy showed that ten PKC isoforms - PKCalpha, PKCbetaI, PKCbetaII, PKCdelta, PKCepsilon, PKCtheta, PKCxi, PKCiota, PKClambda and PKCmu - appeared almost exclusively in the cytoplasm of the cells. However, PKCgamma and PKCeta were not detected by staining. CONCLUSIONS: This study characterized the expression pattern of all 12 PKC isoforms and showed that ten of these (PKCalpha, PKCbetaI, PKCbetaII, PKCdelta, PKCepsilon, PKCtheta, PKCmu, PKCxi, PKClambda and PKCiota) are present in cultured human RPE cells. This identification provides the first step towards elucidating their roles in RPE cell proliferation.

Blotting, Western↗

Statistical assessment of the global regulatory role of histone acetylation in Saccharomyces cerevisiae.

BACKGROUND: Histone acetylation plays important but incompletely understood roles in gene regulation. A comprehensive understanding of the regulatory role of histone acetylation is difficult because many different histone acetylation patterns exist and their effects are confounded by other factors, such as the transcription factor binding sequence motif information and nucleosome occupancy. RESULTS: We analyzed recent genomewide histone acetylation data using a few complementary statistical models and tested the validity of a cumulative model in approximating the global regulatory effect of histone acetylation. Confounding effects due to transcription factor binding sequence information were estimated by using two independent motif-based algorithms followed by a variable selection method. We found that the sequence information has a significant role in regulating transcription, and we also found a clear additional histone acetylation effect. Our model fits well with observed genome-wide data. Strikingly, including more complicated combinatorial effects does not improve the model's performance. Through a statistical analysis of conditional independence, we found that H4 acetylation may not have significant direct impact on global gene expression. CONCLUSION: Decoding the combinatorial complexity of histone modification requires not only new data but also new methods to analyze the data. Our statistical analysis confirms that histone acetylation has a significant effect on gene transcription rates in addition to that attributable to upstream sequence motifs. Our analysis also suggests that a cumulative effect model for global histone acetylation is justified, although a more complex histone code may be important at specific gene loci. We also found that the regulatory roles among different histone acetylation sites have important differences.

Acetylation↗

Effects of direct intravitreal dopamine injections on the development of lid-suture induced myopia in rabbits.

BACKGROUND: Dopamine (DA) storage and release are reduced in form deprivation myopia (FDM) in a wide range of species, from chicks to primates. FDM can be prevented by treatment with DA agonists such as apomorphine, and paradoxically by the dopamine neurotoxin 6-hydroxydopamine. In this study, we increased the DA levels by direct intravitreal DA injections to learn if FDM can be suppressed in a rabbit model. METHODS: Seven-day-old rabbits were deprived of pattern vision by the suturing the right eyelids after natural eye opening. In the first group (FD, n=20), the right eye received form deprivation (FD) alone. In the second group (DA-FD, n=16), the deprived eye of 7-day-old rabbits received four intravitreal injections of 20 microg dopamine every 5 days. In the third group (saline-FD, n=16), the deprived eye received saline injections with the same schedule. The contralateral eye remained untreated as a control. At the end of the 8-week deprivation period, the effects of DA on refractive error, corneal curvature and ocular dimensions were assessed by streak retinoscopy, keratometry and A-scan ultrasonography, respectively. RESULTS: Eight weeks of FDM induced a myopic shift of -2.70+/-0.87 D (n=20) in treated eyes compared with contralateral eyes. The major structural correlate of the myopia appeared to be elongation of the vitreous chamber (0.7+/-0.3 mm, n=20) and axial elongation (0.9+/-0.3 mm, n=20), respectively. Repeated intravitreal injections of DA fully prevented the myopic shift (-0.06+/-0.37 D), elongation of the vitreous chamber (0.1+/-0.3 mm, n=16) and axial elongation (0.3+/-0.2 mm, n=16) due to lid suture, whereas saline injections had slight effect. CONCLUSIONS: FD by suturing eyelids is an effective technique to induce a significant myopic shift, vitreous chamber and axial elongation in rabbits as a model of myopia development. These changes associated with FD were retarded by intravitreal injections of DA.

Animals↗

A data-driven clustering method for time course gene expression data.

Gene expression over time is, biologically, a continuous process and can thus be represented by a continuous function, i.e. a curve. Individual genes often share similar expression patterns (functional forms). However, the shape of each function, the number of such functions, and the genes that share similar functional forms are typically unknown. Here we introduce an approach that allows direct discovery of related patterns of gene expression and their underlying functions (curves) from data without a priori specification of either cluster number or functional form. Smoothing spline clustering (SSC) models natural properties of gene expression over time, taking into account natural differences in gene expression within a cluster of similarly expressed genes, the effects of experimental measurement error, and missing data. Furthermore, SSC provides a visual summary of each cluster's gene expression function and goodness-of-fit by way of a 'mean curve' construct and its associated confidence bands. We apply this method to gene expression data over the life-cycle of Drosophila melanogaster and Caenorhabditis elegans to discover 17 and 16 unique patterns of gene expression in each species, respectively. New and previously described expression patterns in both species are discovered, the majority of which are biologically meaningful and exhibit statistically significant gene function enrichment. Software and source code implementing the algorithm, SSClust, is freely available (http://genemerge.bioteam.net/SSClust.html).

Algorithms↗

[Study on therapeutic dosimetry of HIFU ablation tissue].

It is a difficult problem in high intensity focused ultrasound (HIFU) therapeutic dosimetry that how to use a BFR to ablate a mass in tissue and to determine the energy-efficiency relation, that is, the scale of biological effects of HIFU. A mass lesion was realized in this study according to a treatment principle of damaging tissue from BFRs to fascicle lesions, slice lesions and a mass lesion. A 1.6 MHz transducer, 150 mm in diameter and with a focal length of 120 mm, was used. The focal intensities (I(SATA)) were 0-27 000 W/cm2 and the scanning speeds were 1-4 mm/s. The distance between every fascicle lesion was 5-10 mm and the distance between two slice lesions was 10-20 mm. Different irradiation depths of fascicle slice and mass lesion were observed after HIFU procedures in this study. The dosage of HIFU required for tissue coagulated necrosis was evaluated with energy of HIFU (J) per cubic millimeter (mm3), i.e., J/mm3 which was defined as energy-efficiency factor (EEF). Results showed that EEF needed for producing fascicle lesions increased with the increase of irradiation depth. EEF required for inducing various lesions in biological tissue was different. Generally, it followed the law: EEF(mase)< EEF(slice)<EEF(fascicle). EEF for slice lesion was not simply a summation of EEFs for fascicle lesions at different irradiation depths, although the slice lesion was assembled with fascicle lesions at different irradiation depths in the same treatment slice. In the same way, EEF for a mass lesion was not simple summation of EEFs for slice lesions at different layers. So HIFU therapeutic dosimetry can be carried on investigation by using EEF, Factors of affecting EEF of HIFU include acoustic power, exposure time, irradiation depth, tissue structure, and tissue functional status. Besides, another important factor is the change of the acoustic environment in tissue during the HIFU procedure.

Animals↗

RSIR: regularized sliced inverse regression for motif discovery.

MOTIVATION: Identification of transcription factor binding motifs (TFBMs) is a crucial first step towards the understanding of regulatory circuitries controlling the expression of genes. In this paper, we propose a novel procedure called regularized sliced inverse regression (RSIR) for identifying TFBMs. RSIR follows a recent trend to combine information contained in both gene expression measurements and genes' promoter sequences. Compared with existing methods, RSIR is efficient in computation, very stable for data with high dimensionality and high collinearity, and improves motif detection sensitivities and specificities by avoiding inappropriate model specification. RESULTS: We compare RSIR with SIR and stepwise regression based on simulated data and find that RSIR has a lower false positive rate. We also demonstrate an excellent performance of RSIR by applying it to the yeast amino acid starvation data and cell cycle data. AVAILABILITY: Matlab programs are available upon request from the authors.

Algorithms↗

[Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus].

The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.

Agkistrodon↗

[Preliminary study of inhibition of human Tenon's capsule fibroblasts in vitro by RNA interference targeting IKK-beta].

OBJECTIVE: To determine whether small interference RNA (siRNA) targeting the inhibitor of kappaB kinase-beta (IKK-beta) could be used to suppress the IKK-beta expression, and inhibit the proliferation of human Tenon's capsule fibroblasts in vitro. METHODS: IKK-beta specific siRNA designed from the human gene sequence was transfected into the cultured human Tenon's capsule fibroblasts, and a non-targeted siRNA was transfected as a negative control. The mRNA of IKK-beta was assessed by reverse transcription-polymerase chain reaction (RT-PCR), and the protein expression was determined by Western blotting. Cell viability of the cultured human Tenon's capsule fibroblasts with series of RNA interference at 5, 10, 25, 50, 100, and 200 nmol/L was evaluated by MTT assay 48 hours after transfection. RESULTS: The expression of IKK-beta was significantly (P < 0.05) suppressed at both mRNA and protein levels after transfection. The proliferation of the cultured human Tenon's capsule fibroblasts was inhibited at all the transfected concentrations at different rates (10.72%, 23.35%, 30.84%, 51.25%, 50.06% and 49.63% respectively). The highest level of inhibition was observed at 50 nmol/L of siRNA concentration. CONCLUSIONS: IKK-beta specific siRNA is effective in suppressing the IKK-beta expression and inhibiting the proliferation of the cultured human Tenon's capsule fibroblasts. RNA interference may offer a new alternative to post-operational management of scar tissue formation.

Adult↗

Differentiation potential of bone marrow mesenchymal stem cells into retina in normal and laser-injured rat eye.

Bone marrow mesenchymal stem cells (MSCs) can develop into hematopoietic and mesenchymal lineages but have not been known to participate in the production of retina. Here we report that bone marrow mesenchymal stem cells, after being subretinally transplanted into normal or Nd: YAG laser-injured rat eye, can integrate into RPE layer, photoreceptor layer, bipolar cell layer and ganglion layer. DAPI-labeling detection was used to trace the origin of the repopulating cells. DAPI fluorescence was used to identify retina cells of bone marrow origin 10, 20, 35 and 50 days after transplantation. No formation of rosettes was found but some random cells were found at the end of the observation. MSCs-originated cells spread more widely in the injured retinas than in the normal ones. Immunohistochemical detection showed that though the cells could express neuronal nuclei (NeuN), neuron specific enolase (NSE), glial fibrillary acidic protein (GFAP) and cytokeratin (CK), the proteins expression in the injured transplantation group was abnormal in some region compared with that in the normal transplantation group. Electroretinogram (ERG) showed that ERG-b wave of the injured transplantation group is significantly higher than that of the two laser-injured control groups. These results suggest that a proportion of MSCs can differentiate into retina-like structure in vivo and the differentiation differs in normal and laser-injured retinas.

Animals↗

A microbubble agent improves the therapeutic efficiency of high intensity focused ultrasound: a rabbit kidney study.

Eighty kidneys (40 left and 40 right kidneys) of New Zealand rabbits were ablated using high intensity focused ultrasound (HIFU), (14,300 W/cm(2), 1.0 MHz). Kidneys were randomly divided into two groups. HIFU was performed in the manner of linear scan in both groups. Prior to HIFU, normal saline solution and isovolumetric microbubble agent were administrated intravenously in groups I and II, respectively. HIFU was finished in all left kidneys and in 26/40 right ones. The therapeutic efficiency was reflected using necrosis rate (cubic centimeters per second), which was the tissue volume of coagulative necrosis per 1 s HIFU exposure. In both groups, predetermined volumes were damaged without harming overlying tissues. Necrosis rates were increased in group II both in left (0.0089+/-0.0107 vs. 0.0493+/-0.0777, P=0.0323) and in right (0.0039+/-0.0055 vs. 0.0162+/-0.0168, P=0.0248) kidneys. Pathological examinations confirmed that there were no intact tissue focuses within exposed regions in either group. These findings suggested that the microbubble agent improved the therapeutic efficiency of HIFU. Hemorrhage and hyperemia were also detected on the margin of the ablated tissues (both in cortex and medulla) in both groups.

Animals↗

[Observation of bone marrow mesenchymal stem cells after subretinally transplanted into laser-injured rat retina].

OBJECTIVE: Bone marrow mesenchymal stem cells (MSCs) develop into hematopoietic and mesenchymal lineages but have not been known to participate in production of retina. Eye was known as an immunologically privileged organ. Because of its special structure, it's difficult for blood cells to enter retina. This article is to trace bone marrow mesenchymal stem cell (MSCs) after subretinally transplanted into Nd: YAG laser-injured rat retinal without in vitro differentiation induction. METHOD: 4', 6-diamidino-2-phenylindole (DAPI)-labeled MSCs were used to trace the change of MSCs after transplantation on day 10, 20, 35 and 50. The sequenced sections were used for Immunohistochemistry identification for neuronal nuclei (NeuN), neuron specific enolase (NSE), glial fibrillary acidic protein (GFAP) and pancytokeratin (CK). Electroretinogram (ERG) b waves were recorded for each eye of the laser injured group, the laser injured transplanted group and the laser injured with saline injection control group before, right after or at every end of 1 to 7 weeks. RESULTS: On day 10, the DAPI positive cells were mainly crowded around the transplanted site. On day 20 the positive area enlarged and scattered into RPE layer, photoreceptor layer, bipolar layer and ganglion cell layer. Then the positive area enlarged more widely on day 35 and more cells could be found migrate to the lesion site. The positive area didn't enlarge much on day 50 than on day 35. No formation of rosettes was found during the observation. But the expression of NeuN, NSE, GFAP and CK was not uniform as the normal retina. Cell proliferation was still found. But HE staining showed that the lesion in the transplanted group was better than that of the control group. Correspondingly ERG b-wave value at week 5 was higher than the control group. CONCLUSION: From these cells, a proportion of the cells regenerated from bone marrow can be differentiated into retina in vivo. Although the MSCs-derived cells could not precisely express neuro-like proteins, they could help recover lesion and ERG b-wave value.

Animals↗

Study of a "biological focal region" of high-intensity focused ultrasound.

The aim of this study was to explore a law of energy deposition of high-intensity focused ultrasound (HIFU) in various tissues and the expression of such a law. A focused ultrasound (US) tumor therapeutic system was used to apply a focused US beam to tissues both in vivo and in vitro. The formation of individual ellipsoid-shaped regions of coagulative necrosis has been observed. Results showed that the volume of the ellipsoid-shaped coagulative necrosis region was different from that of the acoustic focal region (AFR), both in vitro and in vivo. Acoustic intensities ranging from 7 x 10(3) W/cm(2) to 27.7 x 10(3) W/cm(2) and exposure times from 1 to 20 s gave volumes of ellipsoid-shaped coagulative necrosis of 0.2 to 2000 mm(3). Although the HIFU doses applied were identical, the volumes of individual ellipsoid-shaped coagulative necrotic regions varied with the structures of tissues, their functional status and the irradiation depths. Individual ellipsoid-shaped regions of coagulative necrosis induced by HIFU can be added to produce coagulative necrosis of an entire tumor. We define the individual ellipsoid-shaped coagulative necrosis produced by the US energy deposition of a single exposure as the "biological focal region" (BFR) of HIFU. This serves as the basic unit for HIFU ablation of tumors, and is plotted as a function of AFR, acoustic intensity, exposure time, irradiation depth, the tissue structure and its functional status.

Animals↗

[Formation of blood resin in abiotic Dracaena cochinchinensis inoculated with Fusarium 9568D].

Fusarium 9568D, which belongs to Fusarium moniliforme, was isolated from the roots of Dracaena cochinchinensis in the suburb of Monglian, Yunnan Province of China. High activities of beta-glucosidase and cellulase were detected in the broth of Fusarium 9568D. The strain was inoculated in abiotic branch and wood of Dracaena cochinchinensis. After 4-5 months of culture, red resin emerged in the inoculated points. UV-IR spectrum analysis and antibiotic assay demonstrated that this resin almost resembled the natural blood resin.

Dracaena↗

[Study of ultrasound attenuation during HIFU propagation in ox liver].

Ultrasound attenuation has been measured during HIFU propagation in fresh ox liver at different frequency using a radiation force method. The acoustic radiation force was measured before and after the prepared ox liver of various thicknesses (20 mm, 40 mm, 60 mm, 80 mm) which were put into degassed water and exposed to different transducer surface output acoustic powers at a room temperature (20 degrees C) with therapeutic transducers of various frequencies, and then the ultrasound attenuation coefficient was calculated. With the use of therapeutic transducer 4, the focus of the ultrasonic beam was set to be 20 mm, 40 mm or 60 mm deep into the tissue surface using B-mode ultrasound guidance. A single exposure was performed with focal intensity ISATA = 22.0 x 10(3) W/cm2(ISATA, in degassed water) and exposure time 5 sec. The sample was cut after treatment to measure the volume of coagulative necrosis. For a specific therapeutic transducer, the radiation force ratio in liver of constant thickness is independent of the transducer surface sound intensity and the area of the ultrasound window at the sample front face. The radiation force ratio and the volume of coagulative necrosis induced by HIFU are plotted as the functions of sample thickness (or exposed depth), in which it can be seen that these two parameters have the same exponential dependence on sample thickness. The ultrasound attenuation coefficient alpha in ox liver is shown to be frequency f dependent, it almost linearly increases with frequency t. This work shows that such a study is feasible, and offers experimental data that will be useful for future HIFU dosage studies.

Animals↗

[Histopathology of congenital pseudarthrosis of tibia].

OBJECTIVE: To investigate the histopathology, origin, and etiology of congenital pseudarthrosis (CPT). METHODS: Specimens of periosteum from 28 CPT cases, 20 cases of traumatic pseudarthrosis (TP), 10 cases of fibromatosis, and 10 normal controls were examined. The pathological changes were observed by electron microscopy and confocal microscopy. The expression of alpha-smooth muscle (SM) actin, vimentin, desmin, bone morphogenic protein (BMP), interleukin (IL)-1, IL-6, tumor necrosis factor-alpha (TNF-alpha) and base fibroblast growth factor (b-FGF) were detected by histochemistry and immunofluorescence chemical staining. Chromosomal karyotype was examined among 11 cases of CPT. RESULTS: (1) Electron microscopy showed that the periosteum and soft tissue between the broken ends in CPT were all dense fibrous connective tissue abundant in cells, including fibroblasts, myofibroblasts, etc. (2) The chief collagen element was type I collagen in normal periosteum and was type III collagen in periosteum of patients with CPT and fibromatosis (P < 0.025). (3) Vimentin was positive and desmin was negative in all specimens. The expression of alpha-SM actin was higher in specimens from CPT and fibromatosis than in specimens from normal control and TP (P < 0.01). The expression of BMP was higher in normal periosteum and TP than in the periosteum of CPT and fibromatosis (P < 0.05). The expression of IL-1, IL-6, TNF-alpha, b-FGF was higher in the periosteum of CPT and TP (P < 0.01). (4) The chromosomal karyotype of all CPT patients was normal 46XY or 46XX. CONCLUSION: (1) Neurofibromatosis is probably not the etiological factor of CPT. (2) CPT is a kind of invasive fibromatosis located in periosteum. (3) Abnormal expression of many kinds of cytokine and high expression of type III collagen play an important role in the pathogenesis of CPT. (4) The main pathology of CPT is hyperplasia of fibroblasts, thus causing thickening of periosteum, contractible circinate coarctation, and compression of tibia and surrounding tissues. (5) The chromosomal karyotype of patients with CPT is normal.

Adolescent↗

[Preparation of rhBMP-2/BCB reconstituted bone xenograft and assay of its osteoinductivity].

OBJECTIVE: To investigate a new grafting material of bone xenograft with strong bone inductive and conductive capacity. METHODS: Based on successful clinical application of the reconstituted bone xenograft (RBX), a new xenograft was made by combining recombinant human bone morphogenetic protein-2 (rhBMP-2) with antigen-free bovine cancellous bone (BCB). Sixty male BALB/C mice aged 4 weeks were divided into study group of 30 and control group of 30 randomly. rhBMP-2/BCB was implanted in the left thigh muscle pouch in the study group and BCB in the control group. The mice were sacrificed at 7 d, 14 d and 21 d after implantation. Inductivity of rhBMP-2/BCB was detected by histological observation and biochemical determination of the samples. RESULTS: Histological examination showed that rhBMP-2/BCB induced chondrogenesis on the 7th day, with woven bone formed on the 14th day, and lamellar bone and marrow on the 21st day, while BCB failed to induce chondrogenesis or osteogenesis on the 7th, 14th and 21st days. The alkaline phosphatase activities and calcium content in study group were higher than those in control group with significant difference (P < 0.01). CONCLUSION: rhBMP-2/BCB is an ideal grafting material with strong bone inductive and conductive capacity without evoking immune reaction.

Animals↗

[Effect of insulin-like growth factor-I on cultured articular chondrocytes of rabbits].

OBJECTIVE: To investigate the influence of insulin-like growth factor-I (IGF-I) on biological characteristics of articular chondrocytes cultured in vitro of rabbits. METHODS: Monolayer articular chondrocytes of 4-week old rabbits were cultured in medium with IGF-I, at the concentrations of 3, 10, 30, 100, and 300 ng/ml. The DNA content in cells and glucuronic acid content in matrix were detected on the 2nd, 4th, 6th days after culture. RESULTS: The DNA content in cells and the glucuronic acid content in matrix in articular chondrocytes cultured in medium with IGF-I at concentrations of 3-300 ng/ml were all significantly higher than those in control group (P < 0.01), which reached the peak at the concentrations of 30-100 mg/ml on the 4th day. CONCLUSION: IGF-I could obviously promote the proliferation of articular chondrocytes in vitro, and there exist time-dependent and dose-dependent effect.

Animals↗