Search PubMed⌕ Search

Biomedical subjects

O Westergaard

Publications and source records attributed to O Westergaard.

At least 55 records · Page 3Linked to original sources

Studies of the topoisomerase II-mediated cleavage and religation reactions by use of a suicidal double-stranded DNA substrate.

The cleavage and religation reactions of eukaryotic topoisomerase II were studied by use of a 5'-recessed DNA substrate containing a strong recognition sequence for the enzyme. Cleavage of the DNA substrate was suicidal, that is the enzyme was unable to religate the cleaved DNA due to a release of DNA 5' to the cleavage position. With this substrate cleavage products accumulated with time in the absence of protein-denaturing agents, and the cleavage reaction was not reversible with salt. The suicide cleavage complexes contained a kinetically competent topoisomerase II enzyme as determined by the enzyme's ability to perform intermolecular ligation of the cleaved DNA to a free 3'-hydroxyl end on another DNA strand. The efficiency of the religation reaction depended on the ability of the religation substrate to base pair to the DNA in the cleaved enzyme-DNA complex. Higher levels of religation were obtained with dinucleotides than with long DNA substrates. Mononucleotides also were efficiently religated, indicating an ability of the enzyme to mediate religation without making contacts to a long stretch of nucleotides 5' to the cleavage position.

Animals↗

Eukaryotic topoisomerase I-DNA interaction is stabilized by helix curvature.

The influence of DNA structure on topoisomerase I-DNA interaction has been investigated using a high affinity binding site and mutant derivatives thereof. Parallel determinations of complex formation and helix structure in the absence of superhelical stress suggest that the interaction is intensified by stable helix curvature. Previous work showed that a topoisomerase I binding site consists of two functionally distinct subdomains. A region located 5' to the topoisomerase I cleavage site is essential for binding. The region 3' to the cleavage site is covered by the enzyme, but not essential. We report here that the helix conformation of the latter region is an important modulator of complex formation. Thus, complex formation is markedly stimulated, when an intrinsically bent DNA segment is installed in this region. A unique pattern of phosphate ethylation interferences in the 3'-part of the binding site indicates that sensing of curvature involves backbone contacts. Since dynamic curvature in supercoiled DNA may substitute for stable curvature, our findings suggest that topoisomerase I is able to probe DNA topology by assessment of writhe, rather than twist.

Base Sequence↗

Drug Stimulated DNA Cleavage Mediated by Cauliflower Topoisomerase II.

We have investigated cauliflower (Brassica oleracea) topoisomerase II with respect to its interaction with DNA and demonstrate that the enzyme shares the characteristics of topoisomerase II purified from a variety of phylogenetically remote organisms. In the presence of the 2-nitroimidazole Ro 15-0216, cauliflower topoisomerase II-mediated DNA cleavage is extensively stimulated (approximately 20-fold) only at a site recognized as a major cleavage site for the enzyme in the absence of drug. The conservation of the enzyme's DNA specificity in the presence of Ro 15-0216 is in contrast to the effect exerted by traditional topoisomerase II inhibitors, which cause enzyme-mediated cleavage to take place at a multiple number of DNA sites. Ro 15-0216 may therefore prove useful as a tool in the elucidation of the enzyme's DNA interaction sites and its involvement in nucleic acid metabolism in plant cells.

Journal Article↗

Stimulation of topoisomerase II mediated DNA cleavage at specific sequence elements by the 2-nitroimidazole Ro 15-0216.

The effect of the 2-nitroimidazole Ro 15-0216 upon the interaction between purified topoisomerase II and its DNA substrate was investigated. The cleavage reaction in the presence of this DNA-nonintercalative drug took place with the hallmarks of a regular topoisomerase II mediated cleavage reaction, including covalent linkage of the enzyme to the cleaved DNA. In the presence of Ro 15-0216, topoisomerase II mediated cleavage was extensively stimulated at major cleavage sites of which only one existed in the 4363 base pair pBR322 molecule. The sites stimulated by Ro 15-0216 shared a pronounced sequence homology, indicating that a specific nucleotide sequence is crucial for the action of this drug. The effect of Ro 15-0216 thus differs from that of the clinically important topoisomerase II targeted agents such as mAMSA, VM26, and VP16, which enhance enzyme-mediated cleavage at a multiple number of sites. In contrast to the previous described drugs, Ro 15-0216 did not exert any inhibitory effect on the enzyme's catalytic activity. This observation might be ascribed to the low stability of the cleavage complexes formed in the presence of Ro 15-0216 as compared to the stability of the ones formed in the presence of traditional topoisomerase II targeted drugs.

Acetanilides↗

Characterization of the interaction between topoisomerase II and DNA by transcriptional footprinting.

The interaction between calf thymus topoisomerase II and DNA has been characterized using a transcription assay. A highly preferred recognition sequence for topoisomerase II was inserted in either direction downstream from a promoter specific for a bacteriophage RNA polymerase. The presence of topoisomerase II-DNA complexes on the template provoked blockage of transcription, yielding RNA transcripts terminated 5' to the topoisomerase II binding site. A footprint of topoisomerase II, derived from transcription towards the complex from either side, revealed that eukaryotic topoisomerase II binds a region of 28 base-pairs with a highly protected central core of 22 base-pairs. The binding region was located symmetrically around the topoisomerase II-mediated cleavage site. In agreement with this result, optimal topoisomerase II-mediated cleavage was observed with a DNA substrate consisting of a 28-mer oligonucleotide homologous to the protected region. Stepwise removal of base-pairs from the ends of the 28-mer gradually reduced the level of enzyme-mediated cleavage.

Acetanilides↗

Minimal DNA requirement for topoisomerase II-mediated cleavage in vitro.

The minimal DNA requirement for topoisomerase II-mediated DNA cleavage in vitro was determined by analyzing the interaction of the enzyme with sets of DNA substrates varying successively by single bases at the 5'- or 3'-end of either strand. A 16-base pair double-stranded region was established as the minimal duplex region required for topoisomerase II cleavage activity. The region was located symmetrically around the 4-base staggered cleavage site. Topoisomerase II-mediated cleavage within the 16-base pair core duplex, however, required single-stranded regions flanking the duplex to either the 5'- or 3'-sides, or an extension at both ends of the duplex with 1 or more base pairs.

Animals↗

Minimal DNA duplex requirements for topoisomerase I-mediated cleavage in vitro.

The minimal DNA duplex requirements for topoisomerase I-mediated cleavage at a specific binding sequence were determined by analyzing the interaction of the enzyme with sets of DNA substrates varying successively by single nucleotides at the 5'- or 3' end of either strand. Topoisomerase I cleavage experiments showed a minimal region of nine nucleotides on the scissile strand and five nucleotides on the noncleaved strand. On the scissile strand, seven of the nine nucleotides were situated upstream to the cleavage site, while all five nucleotides required on the non-cleaved strand were located to this side. The results suggested that topoisomerase I bound tightly to this region, stabilizing the DNA duplex extensively. On minimal substrates which were partially single-stranded downstream to the cleavage site, cleavage was suicidal, that is, the enzyme was able to cleave the substrates, but unable to perform the final religation.

Base Sequence↗

Camptothecin-stabilized topoisomerase I-DNA adducts cause premature termination of transcription.

The antitumor agent camptothecin stabilizes type I topoisomerase-DNA complexes. One of the primary cellular responses to camptothecin exposure is rapid cessation of RNA synthesis. Results obtained by using an in vitro transcription system supplemented with eukaryotic topoisomerase I show that this inhibition can be attributed to physical blockage of the RNA polymerase by camptothecin-stabilized topoisomerase I-DNA complexes on the DNA template. The site of premature termination is located 10 base pairs upstream of the topoisomerase I linked nucleotide residue on the coding strand, corresponding closely to the border of the protected area obtained in a micrococcus nuclease footprint of topoisomerase I. The RNA polymerase transcribes unimpeded through complexes attached to the noncoding strand. No inhibitory effect of camptothecin on RNA transcription was observed with human topoisomerase I isolated from a camptothecin-resistant cell line. Taken together, the data suggest that part of the cytotoxicity of camptothecin is mediated through adduct formation on transcribed DNA, resulting in interference with transcriptional elongation.

Base Sequence↗

Distamycin inhibition of topoisomerase I-DNA interaction: a mechanistic analysis.

Inhibition of eukaryotic DNA topoisomerase I by the minor groove binding ligand, distamycin A, was investigated. Low concentrations of the ligand selectively prevented catalytic action at a high affinity topoisomerase I binding sequence. A restriction enzyme protection assay indicated that the catalytic cycle was blocked at the binding step. Distamycin binding sites on DNA were localized by hydroxyl radical footprinting. A strongly preferred site mapped to a homopolymeric (dA).(dT)-tract partially included in the essential topoisomerase I binding region. Mutational elimination of the stable helix curvature associated with this ligand binding site demonstrated that (i) the intrinsic bend was unessential for efficient binding of topoisomerase I, and (ii) distamycin inhibition did not occur by deformation of a stable band. Alternative modes of inhibition are discussed.

Animals↗

Double-stranded DNA cleavage/religation reaction of eukaryotic topoisomerase II: evidence for a nicked DNA intermediate.

The DNA cleavage reaction of eukaryotic topoisomerase II produces nicked DNA along with linear nucleic acid products. Therefore, relationships between the enzyme's DNA nicking and double-stranded cleavage reactions were determined. This was accomplished by altering the pH at which assays were performed. At pH 5.0 Drosophila melanogaster topoisomerase II generated predominantly (greater than 90%) single-stranded breaks in duplex DNA. With increasing pH, less single-stranded and more double-stranded cleavage was observed, regardless of the buffer or the divalent cation employed. As has been shown for double-stranded DNA cleavage, topoisomerase II was covalently bound to nicked DNA products, and enzyme-mediated single-stranded cleavage was salt reversible. Moreover, sites of single-stranded DNA breaks were identical with those mapped for double-stranded breaks. To further characterize the enzyme's cleavage mechanism, electron microscopy studies were performed. These experiments revealed that separate polypeptide chains were complexed with both ends of linear DNA molecules generated during cleavage reactions. Finally, by use of a novel religation assay [Osheroff, N., & Zechiedrich, E. L. (1987) Biochemistry 26, 4303-4309], it was shown that nicked DNA is an obligatory kinetic intermediate in the topoisomerase II mediated reunion of double-stranded breaks. Under the conditions employed, the apparent first-order rate constant for the religation of the first break was approximately 6-fold faster than that for the religation of the second break. The above results indicate that topoisomerase II carries out double-stranded DNA cleavage/religation by making two sequential single-stranded breaks in the nucleic acid backbone, each of which is mediated by a separate subunit of the homodimeric enzyme.

Animals↗

Strand specificity of the topoisomerase II mediated double-stranded DNA cleavage reaction.

The strand specificity of topoisomerase II mediated DNA cleavage was analyzed at the nucleotide level by characterizing the enzyme's interaction with a strong DNA recognition site. This site was isolated from the promoter region of the extrachromosomal rRNA genes of Tetrahymena thermophila and was recognized by type II topoisomerases from a variety of phylogenetically diverse eukaryotic organisms, including Drosophila, Tetrahymena, and calf thymus. When incubated with this site, topoisomerase II was found to introduce single-stranded breaks (i.e., nicks) in addition to double-stranded breaks in the nucleic acid backbone. Although the nucleotide position of cleavage on both the noncoding and coding strands of the rDNA remained unchanged, the relative ratios of single- and double-stranded DNA breaks could be varied by altering reaction conditions. Under all conditions which promoted topoisomerase II mediated DNA nicking, the enzyme displayed a 3-10-fold specificity for cleavage at the noncoding strand of its recognition site. To determine whether this specificity of topoisomerase II was due to a faster forward rate of cleavage of the noncoding strand or a slower rate of its religation, a DNA religation assay was performed. Results indicated that both the noncoding and coding strands were religated by the enzyme at approximately the same rate. Therefore, the DNA strand preference of topoisomerase II appears to be embodied in the enzyme's forward cleavage reaction.

Animals↗

Interactions between eukaryotic DNA topoisomerase I and a specific binding sequence.

The interaction between eukaryotic DNA topoisomerase I and a high affinity binding sequence was investigated. Quantitative footprint analysis demonstrated that the substrate preference results from strong specific binding of topoisomerase I to the sequence. The specificity was conferred by a tight noncovalent association between the enzyme and its target DNA, whereas the transient formation of a covalently bound enzyme.nicked DNA intermediate contributed insignificantly to the overall affinity. Topoisomerase I protected both strands over a 20-base pair region in which the cleavage site was centrally located. DNA modification interference analysis revealed a 16-base pair interference region on the scissile strand. Essential bases were confined to the 5' side of the cleavage site. The 6-base pair interference region observed on the complementary strand did not contain essential bases.

Animals↗

Sequence-dependent effect of camptothecin on human topoisomerase I DNA cleavage.

We have studied the effect of the antitumor drug, camptothecin, on the interaction of human topoisomerase I with DNA at the sequence level. At a low molar ratio of enzyme to DNA, cleavage is prominent and unique, located at a previously described hexadecameric recognition sequence, while a number of strong additional cleavage sites appear in the presence of the drug. Camptothecin stimulates cleavage at the recognition sequence less than twofold, whereas cleavage at the additional sites is stimulated up to 200-fold. Camptothecin greatly enhances the stability of the cleavable complexes formed at the additional sites, whereas the complex formed at the hexadecameric sequence is only marginally affected. Cleavage was eliminated at certain sites in the presence of camptothecin. Taken together these observations demonstrate that at least three types of potential eukaryotic topoisomerase I cleavage sites can be distinguished by the use of camptothecin. Comparison of the sequences at the additional cleavage sites in the presence of camptothecin reveals that the most frequently cleaved dinucleotide is TG with no consensus for the flanking nucleotides.

Base Sequence↗

Characterization of a camptothecin-resistant human DNA topoisomerase I.

Topoisomerase I purified from a camptothecin-resistant human leukemia cell line and from the parental, camptothecin-sensitive line were compared in vitro. Relaxation of supercoiled DNA by the wild type enzyme was inhibited in the presence of camptothecin, while the mutant enzyme was unimpaired. Camptothecin altered the cleavage pattern of the wild type but not of the mutant enzyme. The stability of cleavable complexes was studied at a preferred topoisomerase I-binding sequence recognized by both enzymes. Camptothecin greatly enhanced the kinetic stability of the cleavable complex formed by the wild type enzyme, whereas that of the mutant enzyme was only marginally affected. In the absence of camptothecin, the cleavable complex formed by the mutant enzyme was stabilized relative to that of the wild type by several criteria. Thus, the mutant enzyme cleaved the topoisomerase I recognition sequence with 2-fold higher efficiency than the wild type enzyme. The mutant cleavable complex had a higher kinetic stability and was less sensitive to salt dissociation than the wild type complex. Furthermore, the mutant enzyme formed cleavable complexes in the absence of divalent cations, which were required for complex formation by the wild type enzyme.

Base Sequence↗

Variable protection by OH scavengers against radiation-induced inactivation of isolated transcriptionally active chromatin: the influence of secondary radicals.

Isolated r-chromatin, the chromatin form of the extrachromosomal gene coding for the rRNA precursor in Tetrahymena, has been used to study radiation-induced inactivation in vitro in the presence of the OH radical scavengers, t-butanol, formate ions, and methanol. Induction of biologically important DNA lesions was detected by the effect on transcription by endogenous RNA polymerases associated with the isolated r-chromatin. The OH scavengers were found to give strong protection in the presence of oxygen as anticipated from previous results obtained with this system. By contrast, only a modest protection was observed under 100% N2 or 100% N2O, and the level of protection was different for each scavenger. The data suggest that secondary radicals may inactivate r-chromatin under anoxia. In the presence of oxygen, the secondary radicals react with O2 to form organic peroxy radicals (or O2-) which seem to be less reactive. Since the protective effect of the OH scavengers varies with the gassing conditions, the dose modifying effects of O2 and N2O relative to N2 depend on the identity and concentration of OH scavenger. The implications for radiation-chemical studies on DNA and living cells are discussed.

Animals↗

Purification and characterization of an inducible mitochondrial DNA polymerase from Tetrahymena thermophila.

Treatment of the eukaryotic organism Tetrahymena with various types of DNA-damaging agents has been reported to cause a 35-fold induction of a mitochondrial DNA polymerase. We here report that the enzyme can be induced in large-scale cultures by exposure of the cells to thymine starvation and/or intercalating agents. The induced DNA polymerase has been purified to near homogeneity, with a specific activity of approx. 300,000 units/mg protein. The relative molecular mass of the active form of the enzyme is approx. 100,000, as determined by glycerol gradient sedimentation. The subunit structure has been analysed by SDS polyacrylamide gel electrophoresis of the highly purified preparation and by immunoprecipitation with a monoclonal antibody directed to the DNA polymerase. A polypeptide of Mr 47,000 has been observed to be a subunit of the enzyme. This corresponds to the size of the subunits suggested for mitochondrial DNA polymerase from chicken embryos and mouse myeloma cells.

DNA-Directed DNA Polymerase↗

Mapping of sequence-specific chromatin proteins by a novel method: topoisomerase I on Tetrahymena ribosomal chromatin.

DNA derived from the 5' spacers of the rRNA genes from Tetrahymena has unusual electrophoretic properties. These properties made it possible to devise a simple electrophoretic procedure for isolating specific rDNA spacer fragments from preparations of total nuclear DNA, enabling us to study DNA modifications at the level of unfractionated nuclei. We have employed the method to study the distribution of topoisomerase I binding sites on the r-chromatin (ribosomal chromatin) of Tetrahymena at the DNA sequence level. The presence of topoisomerase I in situ was detected by its ability to introduce single-strand cleavages into DNA. The positions of the cleavages were determined on DNA sequencing gels after isolation of the fragments. Topoisomerase I binding in r-chromatin is sequence specific and cleavage is confined to a 16 base-pair conserved sequence element previously determined to be a high-affinity binding site for topoisomerase I in vitro. The high degree of sequence specificity may be of important functional significance, as we find a similar sequence specificity with enzymes isolated from five evolutionarily distant species, indicating that preference for the 16 base-pair element is an intrinsic property of eukaryotic type I topoisomerases.

Animals↗

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.

Animals↗