Search PubMed⌕ Search

Biomedical subjects

O Jardetzky

Publications and source records attributed to O Jardetzky.

At least 55 records · Page 3Linked to original sources
PubMed1987

Secondary structure determination of human beta-endorphin by 1H NMR spectroscopy.

The 1H NMR spectra of human beta-endorphin indicate that the peptide exists in random-coil form in aqueous solution but becomes helical in mixed solvent. Thermal denaturation NMR experiments show that in water there is no transition between 24 and 75 degrees C, while a slow noncooperative thermal unfolding is observed in a 60% methanol-40% water mixed solvent in the same temperature range. These findings are consistent with circular dichroism studies by other workers concluding that beta-endorphin is a random coil in water but that it forms 50% alpha-helix or more in mixed solvents. The peptide in the mixed water-methanol solvent was further studied by correlated spectroscopy (COSY) and nuclear Overhauser effect spectroscopy (NOESY) experiments. These allow a complete set of assignments to be made and establish two distinct stretches over which the solvent induces formation of alpha-helices: the first occurs between Tyr-1 and Thr-12 and the second between Leu-14 and extending to Lys-28. There is evidence that the latter is capped by a turn occurring between Lys-28 and Glu-31. These helices form at the enkephalin receptor binding site, which is at the amino terminus, and at the morphine receptor binding site, located at the carboxyl terminus [Li, C. H. (1982) Cell (Cambridge, Mass.) 31, 504-505]. Our findings suggest that these two receptors may specifically recognize alpha-helices.

Amino Acid Sequence↗
PubMed1987

Solution structure of the Trp operator of Escherichia coli determined by NMR.

We have assigned the majority of the nonexchangeable protons in the NMR spectrum of the 20 base-pair fragment of DNA corresponding to the Trp operator of Escherichia coli. The sequence (CGTACTAGTTAACTAGTACG) also contains a Pribnow box (underlined). Variation of the intrinsic spin-lattice relaxation rate constants of the H8's along the sequence indicates that the structure of the oligonucleotide is not regular. Splitting patterns of the H1' resonances in the deoxyriboses, obtained from a two-dimensional J-resolved experiment, allowed the dominant pucker mode of each nucleotide to be determined. Intranucleotide NOEs from the sugar protons H1', H2', and H3' to the base protons were used to determine the conformation of each nucleotide (puckers and glycosidic torsion angles). The relative orientations of nucleotide units (roll, propeller twist, helical twist angle, and pitch) were calculated by using internucleotide NOEs between protons of neighboring nucleotides in the sequence. All these parameters were determined for each step along the 20-mer. The structure belongs to the B family of conformations, but variations of the local geometry are observed from step to step. Some of the variations, such as the roll and the twist angles, can be predicted by the rules of Calladine and Dickerson [Calladine, C. R., & Dickerson, R. E. (1983) J. Mol. Biol. 166, 419-441]. The puckers of the deoxyriboses of purines are found mainly in conformations near C2' endo, while those of the pyrimidines prefer C3' endo and related conformations. Glycosidic torsion angles obtained for purines are larger than those of pyrimidines. Except for this last observation, the general properties of the operator DNA structure are comparable with those of crystal structures of B DNA of other sequences.

Base Sequence↗
PubMed1987

The interaction of the trp repressor from Escherichia coli with the trp operator.

We have examined the interaction of the trp repressor from Escherichia coli with a 20 base-pair synthetic operator. Nonspecific binding was relatively strong (Kd = 2 microM), but only weakly sensitive to the concentration of added salt [d log Kd)/(d log [Na]) = -1). 1H-NMR studies indicate that the structure of the repressor is not greatly altered on forming the complex, and that few if any of the lysine and arginine residues make direct contact with the DNA. However, the mobility of one of the two tyrosine residues is significantly decreased in the complex. The repressor makes close contact with the major grooves of the operator such that the base protons are broadened much more than expected on the basis of increased correlation time. There are large, differential changes in chemical shifts of the imino protons on forming the complex, as well as changes in the rate constants for exchange. The fraying of the ends is greatly diminished, consistent with a target size of about 20 base-pairs. The effects of the repressor on the NMR spectra and relaxation rate constants can be interpreted as a change in the conformation of the operator, possibly a kinking in the centre of the molecule.

Bacterial Proteins↗
PubMed1987

Unfolding of the trp repressor from Escherichia coli monitored by fluorescence, circular dichroism and nuclear magnetic resonance.

The denaturation of the trp repressor from Escherichia coli has been studied by fluorescence, circular dichroism and proton magnetic resonance spectroscopy. The dependences of the fluorescence emission of the two tryptophan residues on the concentration of urea are not identical. The dependence of the quenching of tryptophan fluorescence by iodide as a function of urea concentration also rules out a two-state transition. The circular dichroism at 222 nm decreases in two phases as urea is added. Normalised curves for different residues observed by 1H NMR also do not coincide, and require the presence of at least one stable intermediate. Analysis of the dependence of the denaturation curves on the concentration of protein indicate that the first transition is a partial unfolding of the dimeric repressor, resulting in a loss of about 25% of the helical content. The second transition is the dissociation and unfolding of the partially unfolded dimer. At high concentrations of protein (500 microM) about 73% of the repressor exists as the intermediate in 4 M urea. The apparent dissociation constant is about 10(-4) M; the subunits are probably strongly stabilised by the subunit interaction. The native repressor is stable up to at least 70 degrees C, whereas the intermediate formed at 4 M urea can be denatured reversibly by heating (melting temperature approximately 60 degrees C, delta H approximately 230 kJ/mol).

Bacterial Proteins↗
PubMed1987

Validation of the first step of the heuristic refinement method for the derivation of solution structures of proteins from NMR data.

A new method for the analysis of NMR data in terms of the solution structure of proteins has been developed. The method consists of two steps: first a systematic search of the conformational space to define the region allowed by the initial set of experimental constraints, and second, the narrowing of this region by the introduction of additional constraints and optional refinement procedures. The search of the conformational space is guided by heuristics to make it computationally feasible. The method is therefore called the heuristic refinement method and is coded in an expert system called PROTEAN. The paper describes the validation of the first step of the method using an artificial NMR data set generated from the known crystal structure of sperm whale carbon monoxymyoglobin. It is shown that the initial search procedure yields a low-resolution structure of the myoglobin molecule, accurately reproducing its main topological features, and that the precision of the structure depends on the quality of the initial data set.

Expert Systems↗
PubMed1986

Structure of the toxic domain of the Escherichia coli heat-stable enterotoxin ST I.

Active fragments of the heat-stable enterotoxin ST I of Escherichia coli were chemically synthesized with the sequence Cys-Cys-Glu-Leu-Cys-Cys-Asn-Pro-Ala-Cys-Thr-Gly-Cys-(Tyr) and studied by proton (1H NMR) and carbon-13 (13C NMR) nuclear magnetic resonance spectroscopy as a function of pH and temperature. All of the nonexchangeable protons in the 1H NMR spectrum were assigned. Although all amide protons were present at temperatures below 25 degrees C and and pH values below 6, some of the resonances are broad and could not be assigned. The temperature dependence of these broad resonances indicates a change in conformation that is localized in the N-terminus. Other amide protons disappear at higher temperatures owing to chemical exchange with the solvent. Sufficient resonance assignments can be made at high and low temperatures to permit structural conclusions to be made. The chemical shifts of the alpha-carbon protons indicate the presence of substantial structure, which was further defined with the observed pattern of nuclear Overhauser enhancements (NOEs), coupling constants, and exchange rates. The NMR data identify a turn from Ala-14 to Cys-18. A second likely turn is centered around the proline residue. An interresidue NOE between the alpha-carbon protons of Asn-12 and Gly-17 indicates that the molecule folds back on itself. The NMR information is sufficient to define the structure of the C-terminal region of ST I. Manual model building then indicated that one arrangement of the three disulfides is particularly compatible with the NMR data and van der Waals constraints. A model incorporating the disulfide arrangement proposed by Houghten and his co-workers [Houghten, R.A., Ostresh, J.M., & Klipstein, F.A. (1984) Eur. J. Biochem. 145, 157-162] and the NMR constraints was derived with the programs PROTO [Frayman, F. (1985) Ph.D. Thesis, Northwestern University] and NOEMOT [Lane, A.N., Lefévre, J.-F., & Jardetsky, O. (1986) Biochim. Biophys. Acta 867, 45-56].

Amides↗
PubMed1986

Combined use of 1H-NMR and GC-MS for metabolite monitoring and in vivo 1H-NMR assignments.

Thirty-three metabolites were observed in perchloric acid extracts of four different tissues by in vitro 1H-NMR, GC-MS and alcohol dehydrogenase assay, and the information was used to interpret an in vivo two-dimensional nuclear Overhauser effect 1H-NMR spectrum. The metabolite profiles of the different tissues indicate a number of potential tissue-specific markers: N-acetylaspartate and gamma-aminobutyric acid for rat brain, glutamine/glutamic acid ratio for dog heart, arginine and sucrose for carrot, and t-aconitate, sucrose, asparagine/aspartic acid concentration ratios for corn roots. gamma-Aminobutyric acid and malate can be regarded as metabolic indicators for stressed corn roots. Concentrations of threonine and valine in corn roots were constant under hypoxic and salt stress, and can serve as internal standards for both in vivo and in vitro NMR studies. The in vitro information was further used to identify 12 compounds from the in vivo 1H-NMR spectra (including the two-dimensional nuclear Overhauser effect spectrum) of a carrot cylinder by correlating the chemical shift and nuclear Overhauser effect information. Thus, our choice of methods with a capability for structural determination allows the characterization of complex tissue extracts with minimum sample preparation, and supports, as well as complements, in vivo 1H-NMR investigations of metabolism.

Animals↗
PubMed1986

The effect of the trp repressor from Escherichia coli on the structure and dynamics of dA20dT20.

We have determined the effect of the tryptophan (trp) repressor from Escherichia coli on the structure and dynamics of dA20dT20. The structure was determined using time-dependent nuclear Overhauser effects and spin-lattice relaxation times. The deoxyribose conformation is near C3' endo for the thymine residues, and a mixture of about 30% C3' endo and 70% C2' endo for the adenine residues. The glycosidic torsion angles are -50 degrees for T and -60 degrees for A. The roll is 20 degrees and the propellor twist is about 29 degrees. The conformation is consistent with recent calculations (Rao, K. and Kollman, P.A. (1985) J. Am. Chem. Soc. 107, 1507-1511). The rate constant for exchange of the imino protons is similar to that usually found for AT base-pairs, with an activation energy of 20 +/- 2 kcal/mol, and an activation entropy of 17 +/- 7 cal/mol per K. The repressor greatly retards the exchange of imino protons, and the activation energy increases to 38 kcal/mol. There are small changes in the structure of the DNA on forming the complex, with the adenine and thymidine residues becoming more similar in conformation.

Bacterial Proteins↗
PubMed1986

New strategies for the determination of macromolecular structure in solution.

Non-crystallographic approaches to the determination of protein structure must solve the problem of insufficient and low information content experimental data. Most successful methods augment experimentation with theoretical constraints (for example, potential energy functions or optimization error metrics). We believe it is important to separate the contributions of experimentation and theory in the construction of protein structure. The PROTEAN system defines protein topology on the basis of experimental data alone. Its performance on three data sets, derived from the lac-repressor headpiece of E. coli, sperm whale myoglobin, and domain 1 of bacteriophage T4 lysozyme, indicates that there may be families of related conformations that are consistent with the experimental data. These conformations provide insight into the strengths and weaknesses in the data sets. They also provide a set of structures with which to begin theoretical refinements. We outline here a strategy which maintains a clear distinction between refinements based on theory and those based on experiment, and thus allows a careful analysis of the properties of such refinement methods.

Expert Systems↗
PubMed1985

Nuclear magnetic resonance study of the proton exchange rate in the operator-promoter DNA sequence of the trp operon of Escherichia coli.

The dynamic behavior of a palindromic oligonucleotide (C-G-T-A-C-T-A-G-T-T-A-A-C-T-A-G-T-A-C-G) representative of the operator sequence and containing the Pribnow box of the trp operon of Escherichia coli was investigated. The resonances of the imino protons and of the H2 protons of the adenosine residues were all assigned. The opening rate constants of the base-pairs were calculated by monitoring the exchange rate of the observable imino protons (nine out of ten), using selective temperature (T1) measurements, which avoid the complication of cross-relaxation and spin diffusion. These measurements have to be performed in conditions where the exchange process is much faster than the opening and closing of the base-pairs, so that the observed exchange rate is equal to the opening rate. It is shown that the catalysis of the exchange process by phosphate dianions is not very efficient (kB approximately equal to 7 X 10(4) M-1 S-1). Hence, in phosphate buffer, the necessary opening-rate limiting condition is met only at high pH values (approximately equal to 9.5) where efficient catalysis by OH- takes place, or at very high buffer concentration. While G X C base-pairs show very little exchange, acting in the sequence as molecular "staples", the A X T base-pairs that are protected from the fraying have very different opening and closing rates, depending on the sequence. Although it seems possible that the opening process could occur at the base-pair level, it is localized at most to two base-pairs in that particular sequence. The activation energies for the opening process of all non-fraying base-pairs are very similar (19 +/- 1 kcal mol-1; 1 cal = 4.184 J), and the differences in the opening rates are essentially due to differences in the activation entropies. With regard to the role of this sequence in the promoter, it is observed that the end of the Pribnow box exchanges relatively easily, and that the activation parameters for the "breathing" process and for the isomerization step of the promoter--RNA polymerase are not very different.

Base Sequence↗
PubMed1985

NMR studies of the trp repressor from Escherichia coli. Characterisation and assignments of residue types.

High-resolution proton nuclear magnetic resonance spectra of the trp repressor of Escherichia coli under various conditions are reported and analysed. The spectrum of the denatured state agrees with that predicted from the amino acid composition, with the exception of the two histidine residues, which have different chemical shifts although they titrate normally. The spectrum of the native protein shows the presence of extensive secondary and tertiary structure. Using information from chemical shifts, numbers of protons, titration behaviour, homonuclear chemical-shift-correlated spectroscopy and nuclear Overhauser enhancement correlated spectroscopy, most of the aromatic protons have been assigned to residue type. Further, about 30% of the aliphatic protons have been assigned to residue type by two-dimensional spectroscopy. Nuclear Overhauser enhancements establish that high-field methyl groups belonging to a valine residue lie directly over an aromatic ring.

Bacterial Proteins↗
PubMed1985

Preliminary identification of the secondary structure of the trp repressor from Escherichia coli.

The probable secondary structure content of the trp repressor from Escherichia coli has been inferred from NMR and circular dichroic measurements; the results are compared with those of prediction algorithms. 70% of the amide protons have exchange rate constants orders of magnitude smaller than the intrinsic rate constants, identifying them as participating in hydrogen bonds. The exchange rate constants fall into two distinct classes, one having half-lives of 20 min and the other more than 24 h. The latter class, consisting of 50% of all amide protons, indicates a stable core. The exchange data are consistent with circular dichroism and predictions that suggest that about 55% of the peptides from alpha helix, and 20% form beta sheets and turns. The NMR spectrum further indicates that there is little beta sheet, suggesting that the secondary structure class is alpha.

Amides↗
PubMed1985

Identification of surface residues in the trp repressor of Escherichia coli.

A subset of the spin systems assigned in the 1H NMR spectrum of the trp repressor in the first paper in this series (our penultimate preceding paper in this journal) can be identified as surface or buried residues on the basis of four independent types of measurement: selective spin-lattice relaxation times; the dependence of line widths on temperature and the concentration of manganous ion; fluorescence quenching; and titration behaviour. Criteria are developed for distinguishing surface and buried residues. The significance for the function of DNA binding proteins is discussed.

Bacterial Proteins↗
PubMed1985

A temperature dependent transition in the Pribnow box of the trp promoter.

Proton NMR spectra of the trp operator-promoter (sequence CGTACTAGTT.AACTAGTACG) show selective changes in chemical shift and relaxation rates over the range of temperature 0-45 degrees C for the non-exchangeable protons of A11 and A12 only. These bases are in the centre of the Pribnow box. The changes imply that at least three conformational states become significantly populated in this range of temperature, and probably involve a change in the propellor twists of A11 and A12 for one transition, and changes in the helical twist and local pitch for the other. As (1) mutations in the Pribnow box that destroy the TAA sequence impair promoter activity, and (2) the abortive initiation assay for RNA polymerase shows a transition near 20 degrees C, we propose that the observed conformational transitions in the trp promoter are an essential feature of good promoters.

Base Composition↗
PubMed1985

Measurement of the sodium membrane potential by NMR.

Using nuclear magnetic resonance (NMR), we have developed a method of noninvasively determining the transmembrane sodium potential in erythrocytes by measuring intracellular and extracellular sodium concentrations. The experimental values correlated well with values obtained from standard flame photometric methods.

Erythrocyte Membrane↗
PubMed1984

Mechanisms of cytoplasmic pH regulation in hypoxic maize root tips and its role in survival under hypoxia.

We show that a transient lactic fermentation provides the signal triggering ethanol production in hypoxic maize root tips. The signal is cytoplasmic pH. This interaction between lactic and ethanolic fermentation permits tight cytoplasmic pH regulation during hypoxia--cytoplasmic pH remaining near neutrality for several hours. Mutant roots unable to synthesize ethanol can neither regulate cytoplasmic pH nor maintain ATP levels during extended periods of hypoxia and, like vertebrate tissues, are less tolerant of hypoxia than normal maize. This indicates that cytoplasmic pH regulation is an important factor in survival under hypoxia.

Cytoplasm↗
PubMed1984

Cytoplasmic acidosis as a determinant of flooding intolerance in plants.

We present evidence that cytoplasmic acidosis is a cause of meristematic death in hypoxic root tips of maize and pea seedlings. Usually, leakage of acid from the vacuole is responsible for cytoplasmic acidosis. Leakage of acid, which occurs earlier during hypoxia in pea root tips than in maize root tips, appears to account for the lower tolerance of peas for hypoxia. Cytoplasmic acidosis is accelerated in maize root tips that are either (i) deficient in alcohol dehydrogenase, so that lactic acid production continues throughout hypoxia, or (ii) exposed to external CO2 during hypoxia, or (iii) perfused slowly so that escape of CO2 produced during ethanolic fermentation is retarded. All three conditions decrease the length of time maize root tips can tolerate hypoxia; more rapid cytoplasmic acidosis is associated with more rapid death under hypoxia. Possible mechanisms by which cytoplasmic acidosis leads to death are suggested; the mechanism does not involve inhibition of glycolysis by low pH.

Anaerobiosis↗