Search PubMed⌕ Search

Biomedical subjects

O F Borisova

Publications and source records attributed to O F Borisova.

At least 37 records · Page 2Linked to original sources
PubMed1990

Four-stranded DNA helices: conformational analysis of regular poly(dT).poly(dA).poly(dA).poly(dT) helices with various types of base binding.

The paper presents results obtained in conformational analysis of homopolymeric four-stranded poly(dT).poly(dA).poly(dA).poly(dT) DNA helices in which the pairs of strands with identical bases are parallel and have a two-fold symmetry axis. All possible models of base binding to yield a symmetric complex have been considered. The dihedral angles of sugar-phosphate backbones and helix parameters, which are consistent with the minima of conformational energy for four-stranded DNAs, have been determined using the results of optimization of conformational energy calculated at atom-atom approximation. Potential energy is shown to depend on the structure of base complexes and on the mutual orientation of unlike strands. Possible biological functions of four-stranded helices are discussed.

Base Composition↗
PubMedDate not supplied

Fluorescent 2-pyrimidinone nucleoside in parallel-stranded DNA.

Stretches of parallel-stranded (ps) double-helical DNA can arise within antiparallel-stranded (aps) Watson-Crick DNA in looped structures or in the presence of sequence mismatches. Here we studied an effect of a pyrimidinone-G (PG) base pair on the stability and conformation of the ps DNA to explore whether P is useful as a structural probe.

Base Pair Mismatch↗
PubMedDate not supplied

[Secondary structure of nuclear precursors of the informational RNA (pre-mRNA)].

The secondary structure of pre-mRNA species from mouse Ehrlich ascites carcinoma cells extracted with phenol at the temperatures either 55-65 degrees C or 65-85 degrees C was investigated. A fraction of the double helical regions of pre-mRNA was estimated by two methods: a) by recording of melting curves; b) by measuring fluorescence lifetimes of acridine orange dye adsorbed on the nucleic acid. This fraction was about 64-68%. Further lowering of ionic strength down to 0.024 results in 10-15% decrease in the fraction of double regions. Both lowering of ionic strength and increase of the temperature up to 50-55 degrees C results in despiralisation of pre-mRNA regions which contain more than 70% of AU-nucleotide pairs. Only regions containing mainly GC-nucleotide pairs remain double-stranded under heating to temperatures above 50 degrees C. These facts were established on the basis of studies of acriflavin dye complexes with pre-mRNA.

Animals↗
PubMedDate not supplied

[Conformational polymorphism and extensibility of DNA quadruplexes formed from d(GT)n repeats].

We showed earlier that oligonucleotides 3'-d(GT)5-pO(CH2CH2O)3p-d(GT)5-3' form bimolecular quadruplexes with parallel orientation of their strands, which are held by guanine quartets alternating with unpaired thymines (GT quadruplex). This work deals with the conformational polymorphism and extensibility of G quadruplexes in complex with molecules of an intercalating agent ethidium bromide (EtBr). A cooperative mechanism of EtBr binding to the GT quadruplex was revealed. The binding constant K = (3.3 +/- 0.1) x 10(4) M-1, cooperativity coefficient omega = 2.5 +/- 0.2, and maximal amount of EtBr molecules intercalated in GT quadruplex (N = 8) were determined. It was proved experimentally by analysis of adsorption isotherms and theoretically by mathematical modeling that the GT quadruplex is capable of double extension, which is indicative of the high elasticity of this four-stranded helix. Two most stable conformations of GT quadruplexes with thymine residues intercalated and/or turned outside were found by mechanico-mathematical modeling. The equilibrium is shifted toward the conformation with the looped out thymine residues upon intercalation of EtBr molecules into the GT quadruplex.

Base Sequence↗
PubMedDate not supplied

[Fluorescence of meso-tetrakis(4-(carboxy)phenyl)porphine covalently bound to oligonucleotides d(CG)5 and d(TA)5].

The amino-reactive derivative of tetraphenylporphine meso-tetrakis[4-(carboxy)phenyl]porphine (TCPP) was synthesized, which is characterized by a high molar absorption coefficient (epsilon 416 = 36,500 M-1.cm-1). TCPP was covalently attached to oligonucleotides d(CG)5 [d(CG)5-TCPP] and d(TA)5 [d(TA)5-TCPP]. The spectral characteristics of these complexes were studied in 0.01 M phosphate buffer, pH 7 at 23 degrees C. UV-visible absorption spectra of these complexes have a clearly pronounced Soret band at (414 +/- 1) nm for d(CG)5-TCPP and at (412 +/- 1) nm for d(TA)5-TCPP. The fluorescence spectra of these complexes have maxima at (648 +/- 2) nm for d(CG)5-TCPP and at (658 +/- 2) nm for d(TA)5-TCPP. In this study we also determined fluorescence quantum yields q and fluorescence lifetimes tau [q = 0.099 +/- 0.011, tau = (9.0 +/- 0.3) ns for d(CG)5-TCPP and q = 0.080 +/- 0.011, tau = (8.7 +/- 0.3) ns for d(TA)5-TCPP]. A temperature rise from 5 to 50 degrees C produced only slight (within 23%) emission changes in both samples studied. Taking into account: a) high fluorescence yields (q), b) weak dependence of q on temperature, c) weak q dependence of q on the oligonucleotide type, we conclude that TCPP may be used as a sensitive fluorescence label in DNA studies.

Fluorescence↗
PubMedDate not supplied

[Parallel-stranded DNA with natural base sequences].

Noncanonical parallel-stranded DNA double helices (ps-DNA) comprising natural nucleotide sequences are usually second in stability to antiparallel-stranded (aps) canonical DNA structures, which ensures reliable cell functioning. However, recent data indicate a possible role of ps-DNA in DNA loops or in trinucleotide repeats connected with neurodegenerative diseases. The review surveys recent studies on the effect of nucleotide sequence on preference of one or other type of DNA duplex. (1) Ps-DNA with mixed AT/GC composition was found to have conformational and thermodynamic properties drastically different from those of Watson-Crick double helix. Its stability depends strongly on the specific sequence in a manner peculiar to the ps double helix, because of the energy disadvantage of the AT/GC contacts. The AT/GC boundary facilitated flipping of A and T out of the ps double helix. Proton acceptor groups of bases are exposed into the both grooves of the ps-DNA and are accessible to solvent and ligands, including proteins. (2) DNA regions containing natural minor bases isoguanine and isomethylcytosine were shown to form ps-DNA with transAT-, trans isoGC, and trans iso5meCG pairs exceeding in stability a related aps duplex. (3) Nucleotide sequence dG(GT)4G from yeast telomeres and microsatellites was demonstrated to form novel ps-DNA with GG and TT base pairing. Unlike d(GT)n and d(GnTm) sequences able to form quadruplexes, the dG(GT)4G sequence formed no alternative double- or multistranded structures in a wide range of experimental conditions, thus suggesting that the nucleotide context governs the observed structural polymorphism of the d(GT)n sequence. The possible biological role of ps-DNA and the prospects of its study are discussed.

Base Pairing↗
PubMedDate not supplied

[Structure of d(GT)n repeating sequences with parallel and antiparallel chains].

The ability of oligonucleotides 3'-d(GT)5pO(CH2)5Opd(GT)5-5' (anti[d(GT)]) and 3'-d(GT)5pO(CH2)6Opd(GT)5-3' (par[d(GT)]) to form hairpins and higher associates is studied. Optical methods of thermal denaturation and circular dichroism as well as the fluorescence of ethidium bromide and acridine orange bound to oligonucleotides were used. At room temperatures the formation of hairpin structure with parallel and antiparallel strands is possible. Thermodynamic parameters of par[d(GT)] and anti[d(GT)] are similar and equal to delta H = -15 kcal/mol, delta S = -50 cal/mol. deg. In the temperature range 3-10 degrees C par[d(GT)] and anti[d(GT)] form four-stranded structures with parallel chains, in which layers of four G-residues alternate with unpaired T-residues being bulged out easily. On comparison of occurrence of alternating (GT)n, (GC)n and (G)n sequences in genome it can be stated that (GT)n biological functions could be connected with conformational possibilities of the four-stranded parallel structures with unpaired T-residues.

Circular Dichroism↗
PubMedDate not supplied

[A triple-stranded "clip" from the oligonucleotide 3'-(dA)10-pO(Ch2Ch2O)3p-(dT)10-pO(CH2CH2O)3-p-(dT)10(-5)].

The temperature dependence of the UV- and CD-spectra of the oligonucleotides 3'-d(A)10-L-(T)10-5' [anti(AT)], 3'-d(A)10-L-d(T)10-3' [par(AT)] and 3'-d(A)10-L-(dT)10-L-(dT)10-5' [tripl(ATT)] (L = -PO(CH2CH2O) 3p-) in the phosphate buffer at pH 7 under different concentrations of NaCL and in the presence or absence of 0.01 M MgCl2 was studied. All registered structural changes are the result of intramolecular processes if the concentrations of the oligonucleotides is low (about 2.2.10(-5) M). Par(AT) and anti(AT) exist in the only two forms, transforming into each other: under low temperatures they exist as hairpins with the parallel or antiparallel orientation of chains accordingly which transform into unfolded chains when the temperature increased. In contrast trip(ATT) exists in the three different forms depending on the temperature and ion conditions. They are: the three- stranded clip, the two-stranded hairpin with a single stranded "tail" and completely unfolded chain. For the first time this work presents thermodynamic parameters of the triplex formation from deoxyoligonucleotides depending on NaCl concentration. We have registered the CD spectra to one-, two-, and three-stranded forms. Ethidium bromide binding to three-stranded "clip" was investigated, and it was established that molecules of the dye may intercalate into the "clip" with formation of stable complexes (the constant of association 10(6) M-1). It is maximum three molecules of ethidium bromid which may bound to one molecule of the three-stranded clip. It has been shown that the suggested synthetic model (three oligonucleotide blocks combined by hydroxyalkyl chains) is the most convenient for physico-chemical investigations of triplexes today.

Base Sequence↗
PubMedDate not supplied

[Conformational transition of parallel DNA in solutions with decreased water activity].

Conformations of parallel deoxyoligonucleotides 5'd(CTATAGGGAT)3'/5'd(GATATCCCTA)3' and 5'd(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)3'/'5'd (ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)3' were studied in solution by CD method. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at decreased water activity (relative humidity). This distinctive change is supposed to stem from a cooperative conformational transition of parallel double helix from a B-like form with C2'endo sugar conformation to a A-like form designated as Ap. The free energy difference between Ap- and B-like conformations of the parallel decaduplex is close to that for antiparallel decaduplex with the nucleotide sequence studied. A-phility of a parallel helix is dependent on its sequence.

Base Sequence↗
PubMedDate not supplied

[Complexes of telomeric oligonucleotide d(TTAGGG)4 with the new recombinant protein PGEk--nucleic acid carrier into proliferating cells].

The complexation of the new protein vector PGEk--a carrier of nucleic acids into proliferating cells with phosphodiester d(TTAGGG)4 (TMO) and phosphorothioate Sd(TTAGGG)4 (TMS) telomerase inhibitor oligonucleotides was studied. PGEk molecule, consisting of 64 amino acids, is comprising the sequence of the human epidermal growth factor EGFh which is hydrophobic cell targeting moiety serving for receptor-mediated endocytosis and an NLS (nuclear localization signal) which is hydrophilic serving as a DNA-binding and selective nuclear import moiety. Experiments were carried out in 0.01 M Na-phosphate buffer contained 0.1 M NaCl, pH 7.8 at 37 degrees C. CD spectral analysis revealed that TMO molecules folded back into intramolecular antiparallel G-quadruplex while TMS molecules were represented as unstructured thread. The number of adsorbed PGEk molecules were estimated using PGEk intrinsic fluorescence decrease and fluorescence polarization increase of PGEk under oligonucleotide titration. Adsorption isotherms were plotted in Scatchard coordinates. We have shown that adsorption of the first two PGEk molecules on TMO and TMS occurs noncooperatively with the high association constants K1(TMO) = (7 +/- 1) x 10(7) M(-1) and K1(TMS) = (3 +/- 0.5) x 10(7) M(-1), respectively. Further adsorption up to 5-6 PGEk molecules on TMO occurrs cooperatively with still high association constant K2(TMO) = (4.0 +/- 1.5) x 10(6) M(-1). TMS oligonucleotide binds the third PGEk molecule rather weakly, K2(TMS) = (8 +/- 2) x 10(5) M(-1). CD spectral analysis revealed that G-quadruplex structure formed by TMO have undergone a partial unfolding by binding of PGEk molecules while single-stranded structure formed by TMS was not affected by binding PGEk. Thus, the tertiary structure of DNA and the number of adsorbed PGEk molecules formed biologically active compounds PGEk: TMO and PGEk: TMS were defined, which are able to penetrate through the membrane of proliferating cells and to suppress their growth.

Active Transport, Cell Nucleus↗
PubMedDate not supplied

[Four-stranded DNA. Conformational analysis of regular spirals of poly(dT).poly(dA).poly(dA).poly(dT) with different base binding variations].

Conformational analysis of four stranded DNA helices poly(dT).poly(dA).poly(dA).poly(dT) with parallel arrangement of the identical sugar-phosphate chains connected by twofold symmetry has been performed. All possible models of symmetrical base binding were checked. By the potential energy optimization the dihedral angles and helices parameters of stable conformations of four stranded polynucleotides were calculated. The dependences of conformational energy on the base complex structure and mutual orientation of the poly(dA).and poly(dT) chains were studied. Possible biological functions of four stranded helices are discussed.

Base Sequence↗
PubMedDate not supplied

[Comparison of the conformation of RNA from phage MS2 and 16S rRNA. Accessibility to nucleases S1 and SV specific to secondary structure and thermal stability].

The hydrolysis of E. coli 16S rRNA by nucleases specific to the secondary structure elements (S1 and SV), the melting of the RNA after partial hydrolysis by nuclease S1 and the electrophoretic mobility of hydrolysis products after denaturation-renaturation of RNA were studied. It was shown that the sensitivity of 16S rRNA to nuclease S1 depends on Zn or Mg ions concentration. The melting curves after partial hydrolysis by nuclease S1 were characterized by a decrease of the hyperchromic effect (by approximately 15%) and by a increase of Tm (by 3 degrees). After RNA denaturation followed by slow or fast renaturation the electrophoretic patterns of the hydrolysis products were not changed, as in the case of phage MS2 RNA. It was supposed, that the rRNA molecule has a stable "nucleus" (or "nuclei"), which is organized as an intramolecular association of parallelly oriented double-stranded fragments of this RNA. Previously, such a mode of the spatial organization was proposed by us for phage MS2 RNA.

Coliphages↗