About maize transposable elements and development.
Explore the source record for details and available documents.
Biomedical subjects
Publications and source records attributed to N V Fedoroff.
Explore the source record for details and available documents.
Maize Suppressor-mutator (Spm) transposable elements have been introduced into tobacco cells and a visual assay for Spm activity has been developed using a bacterial beta-glucuronidase gene. The Spm element is mobile in tobacco and can trans-activate excision of a transposition-defective Spm (dSpm) element either from a different site on the same transforming Ti plasmid or from a second plasmid. An Spm element expressed from the stronger cauliflower mosaic virus 35S promoter trans-activates transposition of a dSpm element earlier after its introduction into tobacco cells than an element expressed from its own promoter.
Deletion mutants have been derived from a plasmid-cloned repeating unit of Xenopus laevis oocyte 5S DNA by introducing the transposable chloramphenicol-resistance element Tn9 into the AT-rich spacer sequence near the 5' terminus of the X. laevis 5S rRNA gene in a recombinant plasmid and then selecting plasmids which had lost the transposable element. Plasmids lacking the entire transposable element and various portions of the AT-rich spacer sequence flanking the original site of Tn9 integration have been obtained, and their ability to support transcription of the remaining X. laevis 5S rRNA gene has been tested in X. laevis oocyte nuclei. The deletion mutants analyzed in the present study retain the 49 nucleotide nonrepetitive sequence immediately adjacent to the 5' terminus of the gene, but lack as much as 80% of the repetitive AT-rich spacer sequence (Fedoroff and Brown, 1978). Such deletion mutants are fully active templates for 5S rRNA synthesis. This implies that the AT-rich spacer, which comprises half or more of each repeating unit in X. laevis oocyte 5S DNA, is relatively unimportant for correct initiation of transcription, and that if there are extragenic sequences with promoter function, they are likely to reside in the short nonrepetitive region immediately adjacent to the gene.
Explore the source record for details and available documents.
The primary sequence of the principal spacer region in X. laevis oocyte 5S DNA has been determined. The spacer is AT-rich and comprises half or more of each repeating unit. The sequence is internally repetitious; most of it can be represented by the following set of oligonucleotides: CAACAGTTTTCAAAAGGTTTCGAAGTTTTT(T). The spacer, which varies in length from about 360 to 570 or more nucleotides, can be subdivided into a region (A2) which is variable in length in different repeating units, flanked by regions (A1, A3, B1) which are relatively constant in length. The A2 region consists, on the average, of 5-6 tandem copies of the oligonucleotide CAAAGTTTGAGTTTT; variation in the redundancy of this oligonucleotide accounts for much of the repeat length variation in the genomic 5S DNA. Most copies of this oligonucleotide are identical, although several differing by 1 or 2 nucleotides have been detected in plasmid-cloned 5S DNA fragments. Regions A1 and A3 comprise a linear array of similar, but not identical, oligonucleotides; most repeating units contain very similar A1 and A3 sequences. Region B1 is a sequence of 49 nucleotides immediately adjacent to the 5' terminus of the 5S rRNA sequence. It is GC-rich, much less repetitive than the remainder of the spacer and contains several palindromes, but no regions of dyad symmetry. This sequence is identical in all six of the single cloned repeating units of 5S DNA analyzed.
The primary sequence of the GC-rich half of the repeating unit in X. laevis 5S DNA has been determined in both a single plasmid-cloned repeating unit and in the total population of repeatig units. The GC-rich half of the repeating unit contains a single long duplication of 174 nucleotides. The duplicated segment commences 73 nucleotides preceding the 5' end of the gene and terminates at nucleotide 101 of the gene. The duplicated portion of the gene, termed the pseudogene, differs by 10 nucleotides from the corresponding portion of the gene, and the remaining duplicated sequence of 73 nucleotides differs by 13 nucleotides. The plasmid-cloned repeating unit differs from the dominant sequence in the total population repeating units by 6 nucleotides in the GC-rich region. Evidence is provided that most of the CpG dinucleotides in 5S DNA are at least partially methylated.
Explore the source record for details and available documents.