Search PubMed⌕ Search

Biomedical subjects

N Okada

Publications and source records attributed to N Okada.

At least 505 records · Page 28Linked to original sources
PubMed1983

Cytolysis of Sendai virus-infected guinea-pig cells by homologous complement.

Guinea-pig line 10 tumor (GPL10) cells, which were transplantable in strain 2 guinea-pigs, gained the capacity to activate the homologous alternative complement pathway (ACP) following infection with ultraviolet-irradiated Sendai virus (UV-SV). The ACP activation of homologous serum on the UV-SV-infected GPL10 cells (UV-SV-GPL10 cells) resulted in cytolysis of the tumor cells. This indicates that UV-SV infection induced not only the capacity to activate complement on the GPL10 cells, but also made them sensitive to complement attack, because GPL10 cells have been demonstrated to be resistant to the reaction of homologous complement via the classical pathway in the presence of rabbit antibody. Furthermore, UV-SV-GPL10 cells prepared with as little as 0.1 plaque-forming unit equivalent of UV-SV per cell showed suppressed growth in syngeneic strain 2 guinea-pigs. The essential role of complement in the elimination of UV-SV-GPL10 cells in vivo was confirmed by demonstrating that UV-SV-GPL10 could grow in guinea-pigs whose complement had been depleted by administration of cobra venom factor.

Animals↗
PubMed1983

Effect of furosemide on mitochondrial electron transport system and oxidative phosphorylation.

The effects of furosemide on the mitochondrial electron transport system and on oxidative phosphorylation were explored. Furosemide above the concentration of 2 X 10(-3) mol/l was found to inhibit state 3 (ADP-dependent) respiration of the rat liver, renal cortex, renal medulla mitochondria. State 4 (resting) respiration was not affected by furosemide. Furosemide above the concentration of 7.5 X 10(-6) mol/l (substrate: glutamate-malate), and above 5 X 10(-6) mol/l (substrate: succinate) inhibited the respiration of rat liver mitochondria released by 3,5-di-tert-butyl-4-hydroxybenzylidenemalononitrile (SF 6847). This fact exactly indicates that furosemide inhibits the electron transport system in mitochondria. Furosemide at the concentration of 4 X 10(-3) mol/l inhibited the activities of NADH cytochrome c reductase and succinate cytochrome c reductase in sonicated mitochondrial subparticles of beef heart by 78.2% and 79.2% of control, respectively.

Animals↗
PubMed1983

[Clinical study of cefroxadine in the field of obstetrics and gynecology].

Clinical study of cefroxadine (CXD), an orally active cephalosporin, for the treatment of infections in the field of obstetrics and gynecology was carried out and the following results were obtained. Fifteen strains were isolated in present study. These isolates were mainly E. coli and anaerobes (Peptococcus sp., Peptostreptococcus sp.). The distribution of susceptibilities to CXD of E. coli was between 6.25 approximately 12.5 micrograms/ml and that of anaerobes was between 0.39 approximately 1.56 micrograms/ml. These results were similar to those of CEX. CXD was used in the treatment of 11 patients (endometritis 1 case, adnexitis 3 cases, bartholinitis 7 cases). In overall clinical efficacies, patients evaluated as better than "good" were 10 out of 11 (90.9%). Skin eruption was observed in 2 cases. No abnormality in laboratory findings was recognized.

Adult↗
PubMed1983

Membrane sialoglycolipids regulate the activation of alternative complement pathway by liposomes containing trinitrophenylaminocaproyldipalmitoylphosphatidylethaolamine.

We found that liposomes associated with trinitrophenylaminocaproyldipalmitoylphosphatidylethanolamine (TNP-Cap-DDPE) activate the alternative complement pathway (ACP) of guinea-pig. The complement-activating capacity (CAC) of liposomes with TNP-Cap-DPPE (TNP-Cap-liposomes) was found to be inhibited by the insertion of sialoglycolipids such as GM3 onto the membrane. However, neutral glycolipids tested had no inhibitory effect on the CAC of the TNP-Cap-liposomes. The minimum amount of sialoglycolipids required for the inhibition of the ACP-activating capacity of TNP-Cap-liposomes was 0.01 or less in molar ratio to dimyristoylphosphatidylcholine in the liposomes. Since the insertion of charged amphiphiles did not affect the status of TNP-Cap-liposomes containing glycolipids with respect to their ACP-activating capacity, the surface potential caused by sialoglycolipids was disregarded as being the factor responsible for restriction of the complement-activating effect. For the inhibitory effect to be manifested, it was demonstrated that the presence of GM3 was required on the same liposome membrane as where the TNP-Cap-triggered ACP activation is taking place. Therefore, sialoglycolipids may inhibit ACP activation by reacting directly on certain nascently activated complement proteins. However, insertion of GM3 could not inhibit liposome lysis via the classical complement pathway. Furthermore, the presence of antibody reaction significantly reduced the inhibitory capacity of GM3 indicating that natural antibody may be responsible for discriminating between self and heterologous surfaces, thus cancelling the glycolipid-mediated restriction of ACP activation in the case of heterologous cell surface, bringing about lysis by the cancellation of the glycolipid-mediated restriction of ACP activation on heterologous cell surfaces.

Animals↗
PubMed1982

Metabolism of an aromatic retinoid Ro 10-9359 by cultured human epidermal keratinocytes.

An aromatic retinoid Ro 10-9359 is metabolized after absorption from intestine to form Ro 10-1670 which is an active therapeutic compound. The epidermal keratinocytes, a main target tissue of retinoid therapy in dermatology, was examined in the capacity to metabolize the retinoid. The culture of human epidermal keratinocytes was treated with 10(-6) M Ro 10-9359 and the metabolites released in the medium was analyzed by HPLC. The HPLC profile showed a distinct peak of Ro 10-1670. The human skin fibroblasts, HeLa cells. Chang liver cells and 3T3 cells were less active in metabolizing Ro 10-9359, and only a small amount of Ro 10-1670 was detected in the culture of human skin fibroblasts treated with 10(-6) M Ro 10-9359 for 2 days. When these cells were disrupted by a glass homogenizer, and incubated with Ro 10-9359, no Ro 10-1670 formation was detected.

Acitretin↗
PubMed1982

von Recklinghausen's disease and malignant changes in three patients.

Three Japanese patients with von Recklinghausen's disease and malignant changes were studied. The primary lesions of malignant changes were the chest wall in Case 1, the buttock in Case 2, and the neck in Case 3. After excision of the tumors, there were local recurrences in Cases 1 and 2. Distant metastases developed during treatment in these patients. One of the patients (Case 1) died 21 months after the initial diagnosis of malignancy. Multidisciplinary treatment was of some value in suppressing local recurrences and pulmonary metastases in Case 2. Pulmonary metastases were evident at the time of admission to our hospital in Case 3. Although the primary and metastatic tumors were removed, the patient died 8 months after the initial diagnosis of malignancy. We conclude that careful follow-up should be required in patients with von Recklinghausen's disease because of the possibility of malignant changes. When there is a suspicion of malignancy, an extended en-block excision must be performed.

Adolescent↗
PubMed1982

Sequence determination of rat U5 RNA using a chemical modification procedure for counteracting sequence compression.

Using post-labeling techniques, the nucleotide sequence of a major species of U5 RNA isolated from rat liver was determined to be: XpppAmUmACUCUGGUUUCUCUUCAGAUCGUAUAAAUCUUUCGmCCUUmUpsiACmNAAAGAUpsiUCCGUGGAGAGGA ACAACUCUGAGUCUUAAACCAAUUUUUUGAGGCCUUGUCUUGA(G)CAAGGCUOH. The 5'-end of the RNA is blocked with a cap structure. In addition to the modified nucleotides around the 5'-end (XpppAmUmA), U5 RNA contains Gm at position 38, Um at position 42, psi at position 44, Cm at position 46, N at position 47, and psi at position 54 as modified nucleotides. U5 RNA is present as a mixture of several species with microheterogeneity, whose lengths are 117, 118, or 119 nucleotides. The major species, with 117 nucleotides, comprised approximately 60% of the total U5 RNA. A region near the 3'-end forms a stable second structure, which causes sequence compression on electrophoresis in polyacrylamide gel. To surmount with this obstacle, we developed a chemical modification procedure with sodium bisulfite prior to partial hydrolysis in formamide, which allows denaturation of the secondary structure in polyacrylamide gel containing 7 M urea. The procedure provides a good system for checking RNA sequences determined by electrophoresis in polyacrylamide gel which might have apparent deletions on account of sequence compression.

Animals↗
PubMed1982

Effects of cholera toxin on proliferation of cultured human keratinocytes in relation to intracellular cyclic AMP levels.

In the culture of epidermal keratinocytes, the cellular growth rate is reported to be accelerated by cholera toxin. The mechanism by which cholera toxin exerts biological effects is thought to result from changes in intracellular cyclic AMP concentrations. But in many reports cyclic AMP elevating agents appeared to inhibit growth of keratinocytes in culture. This study was done to clarify the discrepancy of this problem. Determination of cyclic AMP revealed that cholera toxin over a range of 10-14-10-8 M increased the intracellular concentration of cyclic AMP of cultured keratinocytes about 100-fold over the controls after incubation for 6 hr. When a small number (10(5)) of cells were inoculated in a 60 X 15 mm culture dish, cholera toxin strongly stimulated colony growth. When a relatively larger number (8 X 10(5)) of cells were inoculated in a dish, cholera toxin moderately accelerated cell division, and increased DNA and protein levels of the culture during early days of cultivation. But after about 20 days, of cultivation when the culture reached confluence, cholera toxin decreased both DNA and protein content in a culture dish. The cultures were pulse labeled with 3H-thyrmidine at 12 and 24 hr after the addition of 10-10 M cholera toxin, and its uptake into DNA was determined. In the early days of cultivation the uptake of 3H-thymidine increased after treatment with cholera toxin. But in the late days of cultivation, cholera toxin decreased the rate of 3H-thymidine incorporation into DNA. These results indicated that cholera toxin-cyclic AMP has effects on the proliferation of keratinocytes in culture biphasically according to cellular concentrations in culture.

Cell Count↗
PubMed1982

Activation of the alternative complement pathway of guinea-gip by liposomes incorporated with trinitrophenylated phosphatidylethanolamine.

By incorporation of trinitrophenylamino-caproyldipalmitoylphosphatidylethanolamine (TNP-Cap-DPPE) into liposomes composed of an equimolecular mixture of dimyristoylphosphatidylcholine (DMPC) and cholesterol (TNP-Cap-liposomes), liposomes became readily lysed by guinea-pig serum (GPS) in Mg++-EGTA-GVB (gelatin veronal buffered saline containing 2 mM MgCl2 and 10 mM ethyleneglycol-bis (beta-amino-ethyl ether)N-N'-tetraacetate) as well as in GVB++ (gelatin veronal buffered saline containing 0.15 mM CaCl2 and 0.5 mM MgCl2). Since the classical complement pathway (CCP) does not work in Mg++-EGTA-GVB, TNP-Cap-liposome lysis by GPS in Mg++-EGTA-GVB was thought to be mediated by the activation of the alternative complement pathway (ACP). This conclusion was supported by observations that heating of GPS at 50 degrees impaired its lytic activity while C4-deficient GPS was capable of lytic activity, no lysis occurred in EDTA, and there was noted consumption of complement in GPS treated with TNP-Cap-liposomes at 30 degrees. For TNP-Cap-liposome lysis by GPS in Mg++-EGTA-GVB, the epitope density of the TNP hapten was required to be 5% or more of the DMPC. Changing the acyl group of the phosphatidylcholine (PC) significantly influenced the ACP activating capacity of TNP-Cap-liposome. Dipalmitoyl-PC, DMPC and distearoyl-PC facilitated the ACP activating capacity of the TNP-Cap-liposome, while dilauroyl-PC, egg-PC and dioleoyl-PC did not. Furthermore, the length of spacer between TNP and dipalmitoylphosphatidylethanolamine (DPPE) also influenced the ACP activating capacity and maximum activation was noted when the spacer was aminocaproyl. These physicochemical characteristics which increase the ACP activating capacity coincided with those reported to increase the immunogenicity of hapten-sensitized liposomes.

Animals↗