Search PubMed⌕ Search

Biomedical subjects

N Ahmed

Publications and source records attributed to N Ahmed.

At least 163 records · Page 9Linked to original sources
PubMed1990

Transcriptional regulatory elements of the RAS2 gene of Saccharomyces cerevisiae.

We have analyzed a series of 5' deletions of the RAS2 gene to investigate its complex transcriptional regulation in the yeast Saccharomyces cerevisiae. Two positive transcriptional regulatory elements were identified. Element A regulates two of the three clusters of RAS2 transcripts. This element is capable of activating a heterologous promoter and contains two copies of the sequence CCTCGCCCC. Although one copy is sufficient for partial transcriptional activation, both copies are required for maximal RAS2 induction. Deletion of one copy resulted in a reduced level of RAS2 mRNA, selective loss of cluster II transcripts and reduced ability to activate the heterologous CYC1 promoter. Each of the 9 bp C rich repeats of element A is part of a sequence with extensive homology to a transcriptional regulatory element upstream of the human epidermal growth factor receptor (EGFR) gene. Element B contains a tandem duplication of a 21 nucleotide sequence TACATATATATATATCTTAG and activates cluster I RAS2 transcripts in the absence of Element A. The physiological role of these deletions was determined by assaying their ability to support growth on a nonfermentable carbon source. RAS2 promoter deletions containing either element A or B were able to overcome this growth defect characteristic of ras2 mutants cells. Deletion of both elements resulted in an insufficient amount of RAS2 protein for growth on a non-fermentable carbon source.

Base Sequence↗
PubMed1990

Identification and preliminary characterization of protein-cysteine farnesyltransferase.

Ras proteins must be isoprenylated at a conserved cysteine residue near the carboxyl terminus (Cys-186 in mammalian Ras p21 proteins) in order to exert their biological activity. Previous studies indicate that an intermediate in the mevalonate pathway, most likely farnesyl pyrophosphate, is the donor of this isoprenyl group. Inhibition of mevalonate synthesis reverts the abnormal phenotypes induced by the mutant RAS2Val-19 gene in Saccharomyces cerevisiae and blocks the maturation of Xenopus oocytes induced by an oncogenic Ras p21 protein of human origin. These results have raised the possibility of using inhibitors of the mevalonate pathway to block the transforming properties of ras oncogenes. Unfortunately, mevalonate is a precursor of various end products essential to mammalian cells, such as dolichols, ubiquinones, heme A, and cholesterol. In this study, we describe an enzymatic activity(ies) capable of catalyzing the farnesylation of unprocessed Ras p21 proteins in vitro at the correct (Cys-186) residue. This farnesylating activity is heat-labile, requires Mg2+ or Mn2+ ions, is linear with time and with enzyme concentration, and is present in all mammalian cell lines and tissues tested. Gel filtration analysis of a partially purified preparation of protein farnesyltransferase revealed two peaks of activity at 250-350 kDa and 80-130 kDa. Availability of an in vitro protein farnesyltransferase assay should be useful in screening for potential inhibitors of ras oncogene function that will not interfere with other aspects of the mevalonate pathway.

Alkyl and Aryl Transferases↗
PubMed1990

Televised paediatric consultations: a student evaluation of a multipurpose learning strategy.

Since 1984, each student in the sixth-year paediatric rotation in the Department of Paediatrics and Child Health at the University of the Witwatersrand has been videotaped while undertaking a comprehensive paediatric primary care consultation. Video replay of the consultation by each individual student was evaluated by the student together with medical and social work tutors. This incorporated psychosocial aspects, communication skills, doctor-mother-child interactions, as well as essential medical content, clinical examination techniques, and management strategies. The student was expected to provide comprehensive health care, viz. dealing with the presenting health problems, identifying any possible hidden agenda, giving due attention to nutrition, immunization, development, optimal use of available records, health surveillance and appropriate education. This teaching programme was introduced in 1984. In 1988, 68 consecutive final-year medical students completed an anonymous Likert-type evaluation form scoring their perceived learning. They affirmed that the use of television in medical education provides a unique multipurpose learning strategy and in particular enhances awareness of self and of patient/family needs. The time, cost and effort invested in this programme are considered justified.

Clinical Competence↗
PubMed1990

Factors associated with not receiving adequate prenatal care in an urban black population: program planning implications.

REcords of 36,608 Black single live births and 762 infant deaths in Washington, D.C., from 1980 to 1985 were analyzed. Bivariate and multivariate contingency table analysis were carried out to identify the groups at high risk for not obtaining adequate prenatal care. Results show that the groups of mothers which are less likely to receive adequate care also have a high risk of delivering low birthweight infants even when they receive adequate care. The paper focuses on women with high gravidity and short birth intervals for in-depth analysis of programming needs.

Black or African American↗
PubMed1990

Ethnic differences in the consequences of alcohol misuse.

The drinking habits of Asian and indigenous patients receiving in-patient care for alcoholism in West London were studied. Although both racial groups reported similar levels of current alcohol intake, the Asian developed problems and presented for in-patient detoxification with a shorter mean duration of drinking than the indigenous subjects. Values for mean corpuscular volume (MCV) and gamma glutamyl transpeptidase (GGT) were higher in the Asians, suggesting the Asians were at greater risk of alcohol-related physical damage.

Adult↗
PubMed1989

The effects of transmitters on the affinity of the insoluble fraction of ox brain for Na+ and K+.

The insoluble fraction of ox-brain, which had previously been shown to have a non-linear affinity for Na+ and K+, was prepared. Acetylcholine (1 x 10(-8) mol/l and 1 x 10(-7) mol/l) reduced the affinity of the fraction for Na+ and K+ to zero, while at 1 x 10(-6) mol/l, the affinity for the cations was almost as high as in the absence of the transmitter; the affinities for Na+ and K+ were particularly high, when the supernatant concentrations of these ions exceeded 80-100 mM. Addition of eserine (3 x 10(-5) mol/l) considerably modified the response of the fraction to acetylcholine (1 x 10(-5) mol/l). Atropine (1 x 10(-8) mol/l) in the absence or presence of acetylcholine (1 x 10(-5), or 1 x 10(-4) mol/l) reduced the affinity of the fraction for Na+ and K+ to zero. Epinephrine (3 x 10(-10) mol/l) lowered the affinity for Na+ and K+, while ergotamine itself (1 x 10(-5) mol/l) reduced it to zero. The addition of both epinephrine and ergotamine at the latter concentrations restored the affinity of the fractions for Na+ and K+ to what it had been in the absence of the transmitter or antagonist, previously reported. Norepinephrine (3 x 10(-10) mol/l), or ouabain (1 x 10(-7) mol/l) reduced the affinity of the fraction for Na+ and K+ to zero. Thus, the transmitters and antagonists altered the affinity of the insoluble fraction for Na+ and K+ non-linearity, dependent upon their concentrations, the concentrations of the cations, and the interaction of transmitter and antagonist.

Acetylcholine↗
PubMed1989

Retrograde esophagoscopy for foreign body removal.

Foreign bodies of the esophagus may penetrate the wall and migrate extraluminally, requiring a thoracotomy for removal. We report two children who swallowed coins that went undetected for several months and slowly eroded into the esophageal wall. These coins could not be retrieved by upper endoscopy, because of proximal strictures and granulation tissue at the perforation sites. Following surgical gastrostomy and retrograde flexible endoscopy, the coins were successfully removed. Retrograde endoscopy should be considered for removal of foreign esophageal objects before undertaking a thoracotomy.

Child, Preschool↗
PubMed1989

Effect of retraining on nutrition among tribal women volunteers in Bangladesh.

Training programme on Nutrition was carried out on 42 tribal women nutrition volunteers from Rangamati, Khagrachari and Banderban districts of Chittagong Hill Tracts during July 1987 to June 1988. There were a basic training for 10 days and five retrainings of 6 days on the same group. Assessments on the level of their knowledge before and after each training were conducted by a standard questionnaire. Mean score obtained by the trainees initially was 46.28% which increased to 97.23% in the last round. Although the knowledge gain was found statistically significant in each retraining but the retention of knowledge in pre-test of each retraining was found statistically significant (P less than 0.001) upto second round (i.e. 1st retraining) and thereafter the retention was found insignificant (P greater than 0.05).

Bangladesh↗
PubMed1988

Almitrine enhances in low dose the reactivity of pulmonary vessels to hypoxia.

Almitrine bismesylate (Alm) has been shown to increase arterial oxygen tension in patients with chronic obstructive pulmonary disease. This effect is though to be attributable to the enhancement of hypoxic pulmonary vasoconstriction (HPV). We evaluated the effect of various doses of Alm on HPV in terms of blood flow diversion associated with anoxic challenge to the left lower lobe (LLL) in dogs with the LLL and the rest of the lung separately ventilated. The stimulus-response curve shifted to the right with increasing rate of Alm infusion, suggesting that Alm enhances the reactivity of the pulmonary vessels to hypoxia. Low doses of Alm enhanced HPV, while higher doses attenuated it. This suggests that the degree of vasoconstriction in hypoxic and non-hypoxic regions depends on the dose of Alm. The same effects of Alm were also observed in peripheral chemoreceptor denervated dogs. It is supposed that the vasoconstriction induced by Alm may be attributable to a direct effect on pulmonary vessels rather than to a nervous reflex effect.

Almitrine↗
PubMed1988

Pharmacological screening of indigenous medicinal plants (iii).

The effects of the alcoholic extracts of fifteen indigenous plants have been studied on the isolated guineapig ileum preparations. Eleven extracts produced a spasmogenic effect, whereas, four extracts depicted a spasmolytic effect against acetylcholine.

Journal Article↗