Biomedical subjects
Publications and source records attributed to N A Tchurikov.
The main epigenetic mechanisms in regulation of gene expression are discussed. The definition of epigenetics and its specific mechanisms including DNA methylation and gene imprinting, modifications of nucleosomal histones associated with silencing or activation of gene transcription, RNA interference, chromosomal silencing, and the role of mobile elements are discussed.
Gene-specific silencing refers to a phenomenon in which expression of an individual gene can be specifically repressed by different mechanisms on the levels of transcription, RNA splicing, transport, degradation in nuclei or cytoplasm, or blocking of translation. In different species gene-specific silencing was observed by expression or injections of antiparallel double-stranded RNA formed by a fragment of mRNA and antisense RNA. Here we show a potent and specific gene silencing in bacteria by expression of RNA, that is complementary in a parallel orientation to Escherichia coli lon mRNA. Moreover, the expression of parallel RNA is more effective at producing interference than expression of antisense RNA corresponding to the same mRNA region. Both effects of interference mediated either by parallel RNA or antiparallel RNA gradually decrease up to the 40th generation. Together with in vitro nuclease protection studies these results indicate that a parallel RNA duplex might be formed in vivo and both types of duplexes, antiparallel or parallel, can induce gene-specific silencing by similar mechanisms.
We have studied the relationship between chromosomal forum domains and looped domains in the cut locus of Drosophila melanogaster . Forum domains were earlier detected by separation in pulsed-field gels of 50-150 kb chromosomal DNA fragments obtained after spontaneous non-random degradation of chromosomes. We have localized the boundary region where cleavage sites are scattered between two forum domains in the regulatory region of the cut locus. We have sequenced a 13 kb region spanning few kilobases from distal domain, the boundary region and part of the proximal forum domain where several scaffold associated regions (SARs) were observed. We conclude that forum domains and looped domains are physically different types of domains and belong to different levels of organization in eukaryotic chromosomes. The boundary region between the neighboring forum domains in the cut locus possesses the Doc element insertion and a micro-satellite stretch and thus might remind a small island of heterochromatin and correspond to so-called intercalary heterochromatin that is known to be located in the 7B1-2 band where the major part of the cut locus is reside.
The host-controlled EcoK restriction of unmodified phage lambda was five-fold alleviated in the wild-type Escherichia coli strain K12 carrying the R64 plasmid of the incompatibility group I1. The relevant gene was mapped between the origin of vegetative replication (rep, oriV) and the tet(r) gene about 60 kbp downstream from the origin of transfer, oriT. We cloned this gene inside the 613 bp long EcoRI-PstI fragment and sequenced it. Only one 351 bp long open reading frame (ORF) starting at 124 bp from the beginning of the insert was found in the sequence. Computer search in the current databases revealed that the putative protein is identical to the ArsR protein specified by the IncFI plasmid R773. ArsR is a repressor of the arsenical resistance (ars) operon, arsRDABC. There are no arsABC genes in the R64 plasmid since plasmid R64- (or pSR8)-mediated resistance of E. coli K12 cells to the arsenicals arsenate and arsenite was not detected. The gene arsR and the antirestriction genes ard (ardA and ardB) are non-homologous. However, comparison of the deduced amino acid sequence of ArsR with the ArdA and ArdB sequences revealed only one small region of similarity, a 9 amino acid motif found in different antirestriction proteins that is hypothesized to be an interaction site for antirestriction proteins with restriction endonucleases.
The burdock element is known to be the 2.6-kb insertion into the same region of the cut locus in 12 independently obtained ct-lethal mutants. Here we have determined the complete sequences of this insertion and of the hot spot region. It was found that the burdock is a short retrotransposon with long terminal repeats and a single open reading frame (ORF). The polypeptide encoded by the burdock ORF contains two adjacent regions homologous to the gag and pol polyproteins of the gypsy mobile element. The burdock insertion interrupts the short ORF of the cut locus. The target site sequence of the burdock insertions is similar to the Drosophila topoisomerase II cleavage site.
Over the years the structural properties of nucleic acids have been of interest, providing data that may be of importance for DNA and RNA organization and function in the cell. We have attempted to look for the formation of parallel RNA-RNA duplexes in vitro. RNA molecules comprising complementary in the same polarity alternating stretches of A and U of increasing length were enzymatically synthesized and annealed in physiological conditions. The fractionation in the denaturing polyacrylamide gels revealed the formation of two types of full-length parallel RNase A-stable duplexes established either by A-U or by A-A and U-U self pairs. These results suggest novel structural properties of versatile RNA molecules that potentially may be realized in vivo.
Parallel-stranded deoxyoligonucleotide 5'd(CTATAGGGAT)3'/5'd(GATATCCCTA)3' (I-II) was shown to be stable in solution at 3 degrees-5 degrees C, 0.1-0.25 M NaCl, 10(-2) M phosphate buffer, pH 7.0 by means of a set of fluorescent techniques as well as of conventional optical methods. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at decreased water activity (relative humidity, r.h.). This distinctive change is supposed to stem from a cooperative conformational transition of parallel double helix from a B-like form with C2' endo sugar conformation to an A-like form designated as Ap. The free energy difference between the Ap and B-like conformation for the parallel duplex is 7.35 kcal/mol which is close to the value 7.40 kcal/mol for the antiparallel 5'd(CTATAGGGAT)3'/3'd(GATATCCCTA)5' (I-III). The ability of parallel helix to transit into Ap form is important for DNA-RNA parallel double helix formation.
The low-cooperative melting of parallel DNA formed by a natural 40 bp long sequence from Drosophila: 5'-d(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)-3' 5'-d(ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)-3' that possesses a normal nucleotide content was studied by using the special method of measuring the fluorescence of its complex with acriflavine as well as by conventional thermal denaturation. Acriflavine allows discrimination of the melting of AT and GC pairs because its fluorescence is quenched by neighbouring G bases. We have observed that about 40% of AT pairs melt at 14 degrees C while the remainder melt at 42 degrees C. The GC pairs remain stable up to approximately 40 degrees C and melt at 54 degrees C. The higher stability of GC pairs suggests the formation of cis Watson-Crick pairs in parallel DNA.
We have used pulsed-field gel electrophoresis of undigested DNA prepared by cell lysis in agarose with proteinase K detergent treatment and found a resolvable DNA fraction, denoted forum DNA (f-DNA). By changing the pulsed-field gel pulse length from 25 to 4500 sec, to obtain optimal separation in different ranges, we have found f-DNA to occupy a rather broad zone from 2 megabases to 10 kilobases (kb), but mainly at a range between 50 and 150 kb. f-DNA seems to appear as a result of nonrandom spontaneous degradation during cell treatment. The terminal regions of f-DNA segments have been cloned by using a jumping library. The molecular analysis of unique DNA sequence from an anonymous Drosophila DNA segment led to the conclusion that f-DNA appears as a result of nonrandom chromosomal DNA cleavage within sensitive regions that occupy a few kilobases. This conclusion was confirmed by detection of rather discrete hybridization bands on pulsed-field gel Southern blots in a region of good separation of undigested f-DNA after hybridization with different unique and repetitive probes. We propose that f-DNA segments may correspond to some regular higher-order structures in the eukaryotic chromosomes.
We have detected the specific binding in Southern blot hybridization experiments of both complementary antiparallel and parallel 40 bp synthetic DNA probes, corresponding to a cloned Drosophila DNA fragment. The highly cooperative annealing and melting were observed in solution with these probes, which are complementary in the same direction and possess 17 GC pairs. The binding of ethidium bromide is indicative of formation of a perfect parallel DNA duplex. The specific binding was also detected in both genomic and in plaque hybridization experiments.
Based on both the occurrence of families of DNA sequences complementary in the same direction in different genomes and the physical possibility of DNA forming a parallel double helix, we postulate an unusual enzymatic synthesis of parallel DNA on a DNA template from its 5'-end. We discuss the assumed evolutionary aspects of this problem and suggest ways to check the hypothesis.
Using the scanning tunnelling microscopy we have directly observed the parallel stranded DNA of 43 bp in length, containing alternating AT-stretches. The double helix is right-handed and has the same width of each grooves equal to 17.4 A. The average pitch of the helical turn is about 34 A. The parallel double helix possesses no more than 8.6 bases per one turn. The diameter of the parallel stranded DNA molecule is 17-18 A. We conclude that in parallel DNA double helix the angle between N-glycoside bounds in trans-Crick-Watson base pairs is close to 180 degrees.
We have observed the existence of a parallel complementary region between two Drosophila DNA sequences, fragments of the suffix [(1986) EMBO J, 5, 2341-2347] and a 5'-non-coding sequence of the alcohol dehydrogenase gene [(1983) Cell 33, 125-133]. The region includes approximately 40 bp, 76% of which are complementary in the same polarity. Synthetic complementary 16 bp oligonucleotides corresponding to this region which were bound by the 5'-ends through a 1.6-hexanediol bridge form a duplex which displays both melting and annealing as judged by UV absorbance. Anti parallel complementary 16 bp long oligonucleotides bound by the 5'-3' ends through the same bridge and a single-strand sequence were used as controls. The Hoechst 33,258 drug binds to this parallel duplex of DNA; however, the properties of such a complex testify against the B-form of the duplex.
We have cloned from the Oregon R strain of Drosophila melanogaster a 240 kb segment of DNA that contains the cut (ct) locus, and characterized the region for the presence of repetitive elements. Within this region at least five copies of the suffix element were detected, as well as several putatively novel mobile elements. A number of mutations obtained from the unstable ctMR2 strain and its derivatives were mapped within the cut locus. Comparison between parental and daughter strains indicates that frequently two or more independent transposition events involving the cut locus occur simultaneously within a single germ cell, thus providing a molecular basis for the transposition explosion phenomenon.
Recent data obtained in the authors' laboratories concerning the behaviour of mobile genetic elements of Drosophila melanogaster are reviewed. It was found that the mobile element jockey represents the typical LINE element. It is efficiently transcribed in D. melanogaster cells in flies and in culture. Transcription is initiated from the +1 nucleotide of jockey and depends on an internal promoter. This is the first case of an internal promoter being used by RNA polymerase II. Several events which take place during the transposition bursts in ctMR2 family of strains were described. Among them are the removal of mobile dispersed genetics (mdg) elements (with solo long terminal repeat (LTR) remaining at the site of excision), complete removal of an mdg element, and reinsertion of the same mdg to the same place either in the presence or in absence of solo LTR sequence. Finally, the formation of deletions was observed. A 462-bp deletion destroying the white locus can be further repaired (w+ reversion). Thus, transposition bursts include many different genetic events. A novel system of prolonged genome destabilization was described. It depends on mobilization of a new mobile element called Stalker. After certain crosses Stalker actively moves for dozens of generations giving rise to large numbers of insertion mutations. Several novel genes were detected using mobilized Stalker. They include a modifier of mdg4 and six enhancers of yellow mutations.
We have started a cloned genomic DNA fragment approximately 7 kb long (denoted as H55) from the 7B3-4 region in the X chromosome of Drosophila melanogaster. The major part of the fragment is a single-copy sequence. It directs the synthesis of mRNA that makes up approximately 0.1% of the cytoplasmic poly(A)+ RNA from Drosophila embryos. The H55 gene is split by an intervening sequence, yielding a large single-copy exon and a small repetitive 3' exon represented by hundreds of copies in the genome. This repetitive sequence ("suffix") is also present at the 3' ends of approximately 2% of all cytoplasmic poly(A) chains.
Explore the source record for details and available documents.
Ten clones containing the actively transcribed mobile dispersed gene Dm255 and its flanking sequences were selected from the HindIII bank of the Drosophila melanogaster genome. The Dm225 sequences present in these clones were identical while the flanking sequences were different in all of the clones analysed. Four of them contained, in addition to Dm225, other DNA sequences binding high amounts of cytoplasmic poly(A) + RNA. The properties of these new genes are similar to those of Dm255: they are also actively transcribed, multiple in copies, scattered throughout the genome, and located at varying genome sites which also were scattered throughout the whole genome of D. melanogaster. Thus, different mobile dispersed genes often appear as closely apposing units forming gene clusters in the genome.