Biomedical subjects

Maxim D Frank-Kamenetskii

Publications and source records attributed to Maxim D Frank-Kamenetskii.

At least 19 recordsLinked to original sources

PubMed2006

Sequence-dependent base pair opening in DNA double helix.

Preservation of genetic information in DNA relies on shielding the nucleobases from damage within the double helix. Thermal fluctuations lead to infrequent events of the Watson-Crick basepair opening, or DNA "breathing", thus making normally buried groups available for modification and interaction with proteins. Fluctuational basepair opening implies the disruption of hydrogen bonds between the complementary bases and flipping of the base out of the helical stack. Prediction of sequence-dependent basepair opening probabilities in DNA is based on separation of the two major contributions to the stability of the double helix: lateral pairing between the complementary bases and stacking of the pairs along the helical axis. The partition function calculates the basepair opening probability at every position based on the loss of two stacking interactions and one base-pairing. Our model also includes a term accounting for the unfavorable positioning of the exposed base, which proceeds through a formation of a highly constrained small loop, or a ring. Quantitatively, the ring factor is found as an adjustable parameter from the comparison of the theoretical basepair opening probabilities and the experimental data on short DNA duplexes measured by NMR spectroscopy. We find that these thermodynamic parameters suggest nonobvious sequence dependent basepair opening probabilities.

Base Pairing↗

PubMed2006

Monitoring single-stranded DNA secondary structure formation by determining the topological state of DNA catenanes.

Single-stranded DNA (ssDNA) has essential biological functions during DNA replication, recombination, repair, and transcription. The structure of ssDNA must be better understood to elucidate its functions. However, the available data are too limited to give a clear picture of ssDNA due to the extremely capricious structural features of ssDNA. In this study, by forming DNA catenanes and determining their topology (the linking number, Lk) through the electrophoretic analysis, we demonstrate that the studies of catenanes formed from two ssDNA molecules can yield valuable new information about the ssDNA secondary structure. We construct catenanes out of two short (60/70 nt) ssDNA molecules by enzymatic cyclization of linear oligodeoxynucleotides. The secondary structure formed between the two DNA circles determines the topology (the Lk value) of the constructed DNA catenane. Thus, formation of the secondary structure is experimentally monitored by observing the changes of linking number with sequences and conditions. We found that the secondary structure of ssDNA is much easier to form than expected: the two strands in an internal loop in the folded ssDNA structure prefer to braid around each other rather than stay separately forming a loop, and a duplex containing only mismatched basepairs can form under physiological conditions.

DNA, Catenated↗

PubMed2006

Base-stacking and base-pairing contributions into thermal stability of the DNA double helix.

Two factors are mainly responsible for the stability of the DNA double helix: base pairing between complementary strands and stacking between adjacent bases. By studying DNA molecules with solitary nicks and gaps we measure temperature and salt dependence of the stacking free energy of the DNA double helix. For the first time, DNA stacking parameters are obtained directly (without extrapolation) for temperatures from below room temperature to close to melting temperature. We also obtain DNA stacking parameters for different salt concentrations ranging from 15 to 100 mM Na+. From stacking parameters of individual contacts, we calculate base-stacking contribution to the stability of A*T- and G*C-containing DNA polymers. We find that temperature and salt dependences of the stacking term fully determine the temperature and the salt dependence of DNA stability parameters. For all temperatures and salt concentrations employed in present study, base-stacking is the main stabilizing factor in the DNA double helix. A*T pairing is always destabilizing and G*C pairing contributes almost no stabilization. Base-stacking interaction dominates not only in the duplex overall stability but also significantly contributes into the dependence of the duplex stability on its sequence.

Base Pairing↗

PubMed2006

Ab initio DNA synthesis accelerated by endonuclease.

In the presence of an endonuclease that digests double-stranded DNA, DNA polymerase efficiently synthesizes and amplifies DNA from dNTPs in the absence of any added template and primer nucleic acid. This cut-polymerization DNA synthesis (Cut-grow) can be carried out under a wide range of temperature (4-85 degrees C) by many endonucleases and DNA polymerases. The high efficiency of Cut-grow results from an efficient exponential amplification involving digestion-elongation cycles. Our findings suggest that digestion of nucleic acids may play an important role during the evolution of genetic material for procreating the diversification of genetic information on the early earth.

DNA↗

PubMed2005

End invasion of peptide nucleic acids (PNAs) with mixed-base composition into linear DNA duplexes.

Peptide nucleic acid (PNA) is a synthetic DNA mimic with valuable properties and a rapidly growing scope of applications. With the exception of recently introduced pseudocomplementary PNAs, binding of common PNA oligomers to target sites located inside linear double-stranded DNAs (dsDNAs) is essentially restricted to homopurine-homopyrimidine sequence motifs, which significantly hampers some of the PNA applications. Here, we suggest an approach to bypass this limitation of common PNAs. We demonstrate that PNA with mixed composition of ordinary nucleobases is capable of sequence-specific targeting of complementary dsDNA sites if they are located at the very termini of DNA duplex. We then show that such targeting makes it possible to perform capturing of designated dsDNA fragments via the DNA-bound biotinylated PNA as well as to signal the presence of a specific dsDNA sequence, in the case a PNA beacon is employed. We also examine the PNA-DNA conjugate and prove that it can initiate the primer-extension reaction starting from the duplex DNA termini when a DNA polymerase with the strand-displacement ability is used. We thus conclude that recognition of duplex DNA by mixed-base PNAs via the end invasion has a promising potential for site-specific and sequence-unrestricted DNA manipulation and detection.

DNA↗

PubMed2005

Template-independent ligation of single-stranded DNA by T4 DNA ligase.

T4 DNA ligase is one of the workhorses of molecular biology and used in various biotechnological applications. Here we report that this ligase, unlike Escherichia coli DNA ligase, Taq DNA ligase and Ampligase, is able to join the ends of single-stranded DNA in the absence of any duplex DNA structure at the ligation site. Such nontemplated ligation of DNA oligomers catalyzed by T4 DNA ligase occurs with a very low yield, as assessed by quantitative competitive PCR, between 10(-6) and 10(-4) at oligonucleotide concentrations in the range 0.1-10 nm, and thus is insignificant in many molecular biological applications of T4 DNA ligase. However, this side reaction may be of paramount importance for diagnostic detection methods that rely on template-dependent or target-dependent DNA probe ligation in combination with amplification techniques, such as PCR or rolling-circle amplification, because it can lead to nonspecific background signals or false positives. Comparison of ligation yields obtained with substrates differing in their strandedness at the terminal segments involved in ligation shows that an acceptor duplex DNA segment bearing a 3'-hydroxy end, but lacking a 5'-phosphate end, is sufficient to play a role as a cofactor in blunt-end ligation.

DNA Ligases↗

PubMed2004

Very efficient template/primer-independent DNA synthesis by thermophilic DNA polymerase in the presence of a thermophilic restriction endonuclease.

We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 microg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: decreasing AATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNN decreasing), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed.

Archaeal Proteins↗

PubMed2004

Stacked-unstacked equilibrium at the nick site of DNA.

Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.

Base Pairing↗

PubMed2004

Inducing and modulating anisotropic DNA bends by pseudocomplementary peptide nucleic acids.

DNA bending is significant for various DNA functions in the cell. Here, we demonstrate that pseudocomplementary peptide nucleic acids (pcPNAs) represent a class of versatile, sequence-specific DNA-bending agents. The occurrence of anisotropic DNA bends induced by pcPNAs is shown by gel electrophoretic phasing analysis. The magnitude of DNA bending is determined by circular permutation assay and by electron microscopy, with good agreement of calculated mean values between both methods. Binding of a pair of 10-meric pcPNAs to its target DNA sequence results in moderate DNA bending with a mean value of 40-45 degrees, while binding of one self-pc 8-mer PNA to target DNA yields a somewhat larger average value of the induced DNA bend. Both bends are found to be in phase when the pcPNA target sites are separated by distances of half-integer numbers of helical turns of regular duplex DNA, resulting in an enhanced DNA bend with an average value in the range of 80-90 degrees. The occurrence of such a sharp bend within the DNA double helix is confirmed and exploited through efficient formation of 170-bp-long DNA minicircles by means of dimerization of two bent DNA fragments. The pcPNAs offer two main advantages over previously designed classes of nonnatural DNA-bending agents: they have very mild sequence limitations while targeting duplex DNA and they can easily be designed for a chosen target sequence, because their binding obeys the principle of complementarity. We conclude that pcPNAs are promising tools for inducing bends in DNA at virtually any chosen site.

Anisotropy↗

PubMed2004

Two sides of the coin: affinity and specificity of nucleic acid interactions.

During the past decade, synthetic nucleobase oligomers have found wide use in biochemical sciences, biotechnology and molecular medicine, both as research and/or diagnostic tools and as therapeutics. Numerous applications of common and modified oligonucleotides and oligonucleotide mimics rely on their ability to sequence-specifically recognize nucleic acid targets (DNA or RNA) by forming duplexes or triplexes. In general, these applications would benefit significantly from enhanced binding affinities of nucleobase oligomers in the formation of various secondary structures. However, for high-affinity probes, the selectivity of sequence recognition must also be improved to avoid undesirable associations with mismatched DNA and RNA sites. Here, we review recent progress in understanding the molecular mechanisms of nucleic acid interactions and the development of new high-affinity plus high-specificity oligonucleotides and their mimics, with particular emphasis on peptide nucleic acids.

Animals↗

PubMed2004

Specific versus nonspecific binding of cationic PNAs to duplex DNA.

Although peptide nucleic acids (PNAs) are neutral by themselves, they are usually appended with positively charged lysine residues to increase their solubility and binding affinity for nucleic acid targets. Thus obtained cationic PNAs very effectively interact with the designated duplex DNA targets in a sequence-specific manner forming strand-invasion complexes. We report on the study of the nonspecific effects in the kinetics of formation of sequence-specific PNA-DNA complexes. We find that in a typical range of salt concentrations used when working with strand-invading PNAs (10-20 mM NaCl) the PNA binding rates essentially do not depend on the presence of nontarget DNA in the reaction mixture. However, at lower salt concentrations (<10 mM NaCl), the rates of PNA binding to DNA targets are significantly slowed down by the excess of unrelated DNA. This effect of nontarget DNA arises from depleting the concentration of free PNA capable of interacting with DNA target due to adhesion of positively charged PNA molecules on the negatively charged DNA duplex. As expected, the nonspecific electrostatic effects are more pronounced for more charged PNAs. We propose a simple model quantitatively describing all major features of the observed phenomenon. This understanding is important for design of and manipulation with the DNA-binding polycationic ligands in general and PNA-based drugs in particular.

Adsorption↗

PubMed2003

Pseudocomplementary PNAs as selective modifiers of protein activity on duplex DNA: the case of type IIs restriction enzymes.

This study evaluates the potential of pseudocomplementary peptide nucleic acids (pcPNAs) for sequence-specific modification of enzyme activity towards double-stranded DNA (dsDNA). To this end, we analyze the ability of pcPNA-dsDNA complexes to site-selectively interfere with the action of four type IIs restriction enzymes. We have found that pcPNA-dsDNA complexes exhibit a different degree of DNA protection against cleaving/nicking activity of various isoschizomeric endonucleases under investigation (PleI, MlyI and N.BstNBI) depending on their type and mutual arrangement of PNA-binding and enzyme recognition/cleavage sites. We have also found that the pcPNA targeting to closely located PleI or BbsI recognition sites on dsDNA generates in some cases the nicking activity of these DNA cutters. At the same time, MlyI endonuclease, a PleI isoschizomer, does not exhibit any DNA nicking/cleavage activity, being completely blocked by the nearby pcPNA binding. Our results have general implications for effective pcPNA interference with the performance of DNA-processing proteins, thus being important for prospective applications of pcPNAs.

Binding Sites↗

PubMed2003

Artificial site-specific DNA-nicking system based on common restriction enzyme assisted by PNA openers.

We report on the peptide nucleic acid (PNA)-directed design of a DNA-nicking system that enables selective and quantitative cleavage of one strand of duplex DNA at a designated site, thus mimicking natural nickases and significantly extending their potential. This system exploits the ability of pyrimidine PNAs to serve as openers for specific DNA sites by invading the DNA duplex and exposing one DNA strand for oligonucleotide hybridization. The resultant secondary duplex can act as a substrate for a restriction enzyme, which ultimately creates a nick in the parent DNA. We demonstrate that several restriction enzymes of different types could be successfully used in the PNA-assisted system we developed. Importantly, the enzyme cleavage efficiency is basically not impaired on such artificially generated substrates, compared with the efficiency on regular DNA duplexes. Our design originates a vast class of semisynthetic rare-cleaving DNA nickases, which are essentially absent at present. In addition, we show that the site-specific PNA-assisted nicking of duplex DNA can be engaged in a rolling-circle DNA amplification (RCA) reaction. This new RCA format demonstrates the practical potential of the novel biomolecular tool we propose for DNA technology and DNA diagnostics.

Bacterial Proteins↗

PubMed2003

Pausing of DNA polymerases on duplex DNA templates due to ligand binding in vitro.

Using the recently developed peptide nucleic acid (PNA)-assisted assay, which makes it possible to extend a primer on duplex DNA, we study the sequence-specific inhibition of the DNA polymerase movement along double-stranded DNA templates imposed by DNA-binding ligands. To this end, a plasmid vector has been prepared featuring the polylinker with two flanking priming sites to bi-directionally initiate the primer-extension reactions towards each other. Within this plasmid, we have cloned a set of random DNA sequences and analyzed the products of these reactions with several phage and bacterial DNA polymerases capable of strand-displacement synthesis. Two of them, ø29 and modified T7 (Sequenase 2.0) enzymes, were found to be most potent for primer extension in the presence of DNA-binding ligands. We used these enzymes for a detailed study of ligand-induced pausing effects with four ligands differing in modes of binding to the DNA double-helix. GC-specific intercalator actinomycin D and three minor groove-binders, chromomycin A(3) (GC-specific), distamycin A and netropsin (both AT-specific), have been chosen. In the presence of each ligand both selected DNA polymerases experienced multiple clear-cut pauses. Each ligand yielded its own characteristic pausing pattern for a particular DNA sequence. The majority of pausing sites could be located with a single-nucleotide resolution and corresponded to the preferred binding sites known from the literature for the ligands under study. Besides, DNA polymerases stalled exactly at the positions occupied by PNA oligomers that were employed to initiate the primer extension. These findings provide an important insight into the DNA polymerase performance. In addition, the high-resolution ligand-induced pausing patterns we obtained for the first time for DNA polymerase elongation on duplex DNA may become a valuable addition to the existing arsenal of methods used to monitor duplex DNA interactions with various DNA-binding ligands, including drugs.

Base Sequence↗

PubMed2002

Tailoring the activity of restriction endonuclease PleI by PNA-induced DNA looping.

DNA looping is one of the key factors allowing proteins bound to different DNA sites to signal one another via direct contacts. We demonstrate that DNA looping can be generated in an arbitrary chosen site by sequence-directed targeting of double-stranded DNA with pseudocomplementary peptide-nucleic acids (pcPNAs). We designed pcPNAs to mask the DNA from cleavage by type IIs restriction enzyme PleI while not preventing the enzyme from binding to its primary DNA recognition site. Direct interaction between two protein molecules (one bound to the original recognition site and the other to a sequence-degenerated site) results in a totally new activity of PleI: it produces a nick near the degenerate site. The PNA-induced nicking efficiency varies with the distance between the two protein-binding sites in a phase with the DNA helical periodicity. Our findings imply a general approach for the fine-tuning of proteins bound to DNA sites well separated along the DNA chain.

Base Sequence↗

PubMed2002

Kinetics and mechanism of the DNA double helix invasion by pseudocomplementary peptide nucleic acids.

If adenines and thymines in two mutually complementary mixed-base peptide nucleic acid (PNA) oligomers are substituted with diaminopurines and thiouracils, respectively, so-called pseudocomplementary PNAs (pcPNAs) are created. Pairs of pcPNAs have recently demonstrated an ability to highly selectively target essentially any designated site on double-stranded DNA (dsDNA) by forming very stable PNA-DNA strand-displacement complexes via double duplex invasion (helix invasion). These properties of pcPNAs make them unique and very promising ligands capable of denying the access of DNA-binding proteins to dsDNA. To elucidate the sequence-unrestricted mechanism of sequence-specific dsDNA recognition by pcPNAs, we have studied the kinetics of formation of corresponding PNA-DNA complexes at various temperatures by the gel-shift assay. In parallel, the conditions for possible self-hybridization of pcPNA oligomers have been assayed by mixing curve (Job plot) and thermal melting experiments. The data indicate that, at physiological temperatures ( approximately 37 degrees C), the equilibrium is shifted toward the pairing of corresponding pcPNAs with each other. This finding explains a linear concentration dependence, within the submicromolar range, of the pcPNA invasion rate into dsDNA at 37 degrees C. At elevated temperatures (>50 degrees C), the rather unstable pcPNA duplexes dissociate, yielding the expected quadratic dependence for the rate of pcPNA invasion on the PNA concentration. The polycationic character of pcPNA pairs, carrying the duplicated number of protonated terminal PNA residues commonly used to increase the PNA solubility and binding affinity, also explains the self-inhibition of pcPNA invasion observed at higher PNA concentrations. Melting of pcPNA duplexes occurs with the integral transition enthalpies ranged from -235 to -280 kJ.mol(-1), contributing to an anomalously high activation energy of approximately 150 kJ.mol(-1) found for the helix invasion of pcPNAs carrying four different nucleobases. A simplified kinetic model for pcPNAs helix invasion is proposed that interprets all unusual features of pcPNAs binding to dsDNA. Our findings have important implications for rational use of pcPNAs.

DNA↗

PubMed2002

Hybridization of DNA and PNA molecular beacons to single-stranded and double-stranded DNA targets.

Molecular beacons are sensitive fluorescent probes hybridizing selectively to designated DNA and RNA targets. They have recently become practical tools for quantitative real-time monitoring of single-stranded nucleic acids. Here, we comparatively study the performance of a variety of such probes, stemless and stem-containing DNA and PNA (peptide nucleic acid) beacons, in Tris-buffer solutions containing various concentrations of NaCl and MgCl(2). We demonstrate that different molecular beacons respond differently to the change of salt concentration, which could be attributed to the differences in their backbones and constructions. We have found that the stemless PNA beacon hybridizes rapidly to the complementary oligodeoxynucleotide and is less sensitive than the DNA beacons to the change of salt thus allowing effective detection of nucleic acid targets under various conditions. Though we found stemless DNA beacons improper for diagnostic purposes due to high background fluorescence, we believe that use of these DNA and similar RNA constructs in molecular-biophysical studies may be helpful for analysis of conformational flexibility of single-stranded nucleic acids. With the aid of PNA "openers", molecular beacons were employed for the detection of a chosen target sequence directly in double-stranded DNA (dsDNA). Conditions are found where the stemless PNA beacon strongly discriminates the complementary versus mismatched dsDNA targets. Together with the insensitivity of PNA beacons to the presence of salt and DNA-binding/processing proteins, the latter results demonstrate the potential of these probes as robust tools for recognition of specific sequences within dsDNA without denaturation and deproteinization of duplex DNA.

Base Pair Mismatch↗

PubMed2002

Rolling-circle amplification under topological constraints.

We have performed rolling-circle amplification (RCA) reactions on three DNA templates that differ distinctly in their topology: an unlinked DNA circle, a linked DNA circle within a pseudorotaxane-type structure and a linked DNA circle within a catenane. In the linked templates, the single-stranded circle (dubbed earring probe) is threaded, with the aid of two peptide nucleic acid openers, between the two strands of double-stranded DNA (dsDNA). We have found that the RCA efficiency of amplification was essentially unaffected when the linked templates were employed. By showing that the DNA catenane remains intact after RCA reactions, we prove that certain DNA polymerases can carry out the replicative synthesis under topological constraints allowing detection of several hundred copies of a dsDNA marker without DNA denaturation. Our finding may have practical implications in the area of DNA diagnostics.

Base Sequence↗