Leptin resistance and obesity.
Explore the source record for details and available documents.
Biomedical subjects
Publications and source records attributed to Masatomo Mori.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
A lysophospholipase D (lysoPLD) was purified to apparent homogeneity from rat brain nuclear fractions using 1-[(14)C]palmitoyl-glycerophosphorylcholine as a substrate. The abundance of autotaxin (ATX), a secretory lysoPLD, was also estimated for each fraction. The nuclear fraction had relatively high levels of lysoPLD activity but weak immunoreactivity with an anti-ATX antibody. LysoPLD activity was further purified 5550-fold by sequential chromatography. The final preparation migrated as a single band with a molecular weight of 35,000. Anti-ATX antibodies did not cross-react with the purified enzyme. Moreover, enzyme activity was highest at pH 7.0-7.5 and requires Mg(2+). The Km and Vmax values for 1-palmitoyl-glycerophosphorylcholine were 176 microM and 0.3 micromol/min/mg, respectively. The purified enzyme hydrolyzed saturated forms of LPC more robustly than unsaturated forms. The enzyme could hydrolyze platelet-activating factor (PAF) to the same extent as 16:0-LPC, and showed a higher activity toward lysoPAF (1-O-hexadecyl-2-lyso-glycerophosphorylcholine). These results suggested that the lysoPLD purified from rat brain nuclear fractions in this work is a novel enzyme that hydrolyzes lysoPAF, PAF, and LPC to liberate choline.
The brain hypothalamus contains certain secreted molecules that are important in regulating feeding behaviour. Here we show that nesfatin, corresponding to NEFA/nucleobindin2 (NUCB2), a secreted protein of unknown function, is expressed in the appetite-control hypothalamic nuclei in rats. Intracerebroventricular (i.c.v.) injection of NUCB2 reduces feeding. Rat cerebrospinal fluid contains nesfatin-1, an amino-terminal fragment derived from NUCB2, and its expression is decreased in the hypothalamic paraventricular nucleus under starved conditions. I.c.v. injection of nesfatin-1 decreases food intake in a dose-dependent manner, whereas injection of an antibody neutralizing nesfatin-1 stimulates appetite. In contrast, i.c.v. injection of other possible fragments processed from NUCB2 does not promote satiety, and conversion of NUCB2 to nesfatin-1 is necessary to induce feeding suppression. Chronic i.c.v. injection of nesfatin-1 reduces body weight, whereas rats gain body weight after chronic i.c.v. injection of antisense morpholino oligonucleotide against the gene encoding NUCB2. Nesfatin-1-induced anorexia occurs in Zucker rats with a leptin receptor mutation, and an anti-nesfatin-1 antibody does not block leptin-induced anorexia. In contrast, central injection of alpha-melanocyte-stimulating hormone elevates NUCB2 gene expression in the paraventricular nucleus, and satiety by nesfatin-1 is abolished by an antagonist of the melanocortin-3/4 receptor. We identify nesfatin-1 as a satiety molecule that is associated with melanocortin signalling in the hypothalamus.
IL-23 is a heterodimeric cytokine composed of a unique p19 subunit and of a p40 subunit that is also common to IL-12. We defined the distinct signaling mechanisms that regulate the LPS-mediated induction of IL-23 p19 and p40 in human macrophages and dendritic cells. We found that the overexpression of dominant-negative Rac1 (N17Rac1) enhanced LPS-induced IL-23 p19 expression but did not alter p40 expression or IL-12 p70 production in PMA-treated THP-1 macrophages and in human monocyte-derived dendritic cells. Although the inhibition of either p38 MAPK or JNK enhanced LPS-induced p19 expression, N17Rac1 did not influence either p38 MAPK or JNK activation. By contrast, N17Rac1 augmented both NF-kappaB gene expression and p65 trans activation stimulated by LPS without affecting the degradation of IkappaB-alpha or DNA binding to NF-kappaB. Furthermore, small interference RNA of NF-kappaB p65 attenuated cellular amounts of p65 and suppressed LPS-induced p19 expression but did not affect p40 expression. Our findings indicate that Rac1 negatively controls LPS-induced IL-23 p19 expression through an NF-kappaB p65 trans activation-dependent, IkappaB-independent pathway and that NF-kappaB p65 regulates LPS-induced IL-23 p19, but not p40, expression, which causes differences in the control of IL-23 p19 and p40 expression by Rac1.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
An 80-year-old man was referred to our department for evaluation of repetitive loss of consciousness and faintness with hypokalemia. He had relatively low blood pressure, hypomagnesemia, hypocalciuria and chondrocalcinosis in the knee, clinically suggesting Gitelman's syndrome. A renal clearance study could not be carried out due to the patient's age and complications of the heart. Sequence analysis of the gene of thiazide-sensitive Na-Cl cotransporter (TSC) showed a heterozygous missense mutation from C to T at 1712 base pairs from the translation start site, with resultant changes in codon 569 from alanine to valine (A569V). Treatment with oral administration of potassium chloride improved all the symptoms. Although Gitelman's syndrome has been considered to be autosomal recessive, cases of only heterozygous mutation detected have recently been reported. Therefore, the mutation found in this patient may be responsible for Gitelman's syndrome.
BACKGROUND: Non-alcoholic fatty liver disease is a common liver injury, but the pathophysiological mechanisms leading to the development of non-alcoholic steatohepatitis (NASH) remain unclear. The pathological roles of the nuclear receptor constitutive androstane receptor (CAR), a key regulator of drug-metabolising enzymes, in the development of NASH were investigated. METHODS AND RESULTS: CAR(+/+) and CAR(-/-) mice were given a methionine and choline-deficient (MCD) diet to establish a dietary model of NASH. Increases in serum alanine aminotransferase (ALT) and in infiltration of inflammatory cells were dominant in CAR(+/+) mice at 8 weeks. There was no significant difference in the lipid concentration of the liver - namely, the first hit between CAR(+/+) and CAR(-/-) mice. The index of lipid peroxidation increased in liver of the CAR(+/+) mice, as demonstrated by 8-iso-prostaglandin F2alpha (F2-isoprostanes). Western blotting analysis showed that nuclear translocation of CAR occurred in CAR(+/+) mice fed the MCD diet. As a result, the CAR activation caused the lipid peroxidation - namely, the second hit. The expressions of cytochrome P450 (CYP)2B10, 2C29, 3A11 all increased considerably in the CAR(+/+) mice. Furthermore, alpha smooth muscle actin immunohistochemistry and Sirius red staining showed an increase in the degree of fibrosis in CAR(+/+) mice fed the MCD diet at 16 weeks. The mRNA expressions of collagen alpha1(1) and the tissue inhibitor of metalloproteinase-1 were found to be elevated in CAR(+/+) mice. CONCLUSION: CAR caused the worsening of the hepatic injury and fibrosis in the dietary model of NASH. Our results suggest that the CAR nuclear receptor may thus play a critical role in the pathogenesis of NASH.
BACKGROUND: Transforming growth factor alpha (TGFalpha) protects against gastric mucosal injury and facilitates wound healing. However, its overexpression is known to induce hypertrophic gastropathy resembling Menetrier's disease in transgenic (TG) mice on an FVB background, as one of the authors reported previously. We studied another TGFalpha-expressing mouse line on a CD1 background, whose gastric mucosa appears normal. Since this TG mouse had a strong resistance to ethanol-induced gastric injury, we considered the long-term effect of TGFalpha on several gastric protection mechanisms. METHODS: TGFalpha-expressing transgenic (TG) mouse lines bearing human TGFalpha cDNA under the control of the mouse metallothionein gene I promoter were generated on a CD1 mouse background, and analyzed their ethanol injury-resistant phenotypes produced by TGFalpha. RESULTS: In the TG mucosa, blood flow was well maintained after ethanol injury. Further, neural and inducible types of NO synthases were consistently and widely expressed in the TG mucosa, compared with the limited distribution of neural type NO synthase in the luminal pit region of the wild-type (WT) mucosa. COX-2 and its upstream transcription factor NfkB were constitutively elevated in the TG mucosa even before ethanol administration, whereas they were induced in the same region of the WT mucosa only after ethanol injury. Two anti-apoptotic proteins, HSP70 and Bcl-2, were upregulated in the TG mucosa even before ethanol administration, while they were not expressed in the WT mucosa before the injury. Furthermore, pro-caspase 3 activation was inhibited in the TG mucosa, while it was converted to the active form in the WT mucosa following ethanol administration. CONCLUSION: We conclude that TGFalpha maintains the gastric mucosal defense against gastric injury by integrating other cytoprotective mechanisms.
AIM: To evaluate the effect of three interventional treatments involving transvenous obliteration for the treatment of gastric varices, and to compare the efficacy and adverse effects of these methods. METHODS: From 1995 to 2004, 93 patients with gastric fundal varices underwent interventional radiologic embolotherapy at our hospital. Of the 93 patients, 75 were treated with the balloon-occluded retrograde transvenous obliteration (BRTO) procedure; 8 were with the percutaneous transhepatic obliteration (PTO) procedure; and 10 were with the combined BRTO and PTO therapy. A follow-up evaluation examined the rates of survival, recurrence and rebleeding of the gastric varices, worsening of esophageal varices and complications in each group. RESULTS: The BRTO, PTO, and combined therapy were technically successful in 81% (75/93), 44% (8/18), and 100% (10/10) patients, respectively. Recurrence of gastric varices was found in 3 patients in the BRTO group and in 3 patients in the PTO group. Rebleeding was observed in 1 patient in the BRTO group and in 1 patient in the PTO group. The 1- and 3-year survival rates were 98% and 87% in the patients without hepatocellular carcinoma (HCC) in the BRTO group, 100% and 100% in the PTO group, and 90% and 75% in the combined therapy group, respectively. CONCLUSION: Combined BRTO and PTO therapy may rescue cases with uncontrollable gastric fundal varices that remained even after treatment with BRTO and/or PTO, though there were limitations of our study, including retrospective nature and discrepancy in sample size between the BRTO, PTO and combined therapy groups.
Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1-6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (-574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-alpha/thyroid hormone receptor-beta heterodimer bound to Site2, but retinoid X receptor-alpha/liver X receptor- heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-beta recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Prompt treatment in tumor-associated encephalopathy may prolong survival. We describe a 69-year-old male patient who was presented with fulminant hepatic failure, secondary to small-cell lung carcinoma with rapidly progressing encephalopathy. Both symptoms remitted following chemotherapy, suggesting swift diagnosis and administration of chemotherapy to be effective in treatment of fulminant hepatic failure and encephalopathy.