[Hypophosphatasia].
Explore the source record for details and available documents.
Alkaline Phosphatase↗
Biomedical subjects
Masaru Inoue
Publications and source records attributed to Masaru Inoue.
Differences in diagnostic value of four electrocardiographic voltage criteria for hypertrophic cardiomyopathy in a genotyped population.
The diagnostic value of various classic electrocardiographic (ECG) voltage criteria for hypertrophic cardiomyopathy (HC) has not been established in a genotyped population. This study aimed to determine the most accurate diagnostic definition of classic ECG voltage criteria for detecting carriers of HC. ECG and echocardiographic findings were analyzed in 161 genotyped subjects (97 genetically affected, 64 unaffected) from 20 families with disease-causing mutations in 4 genes. The diagnostic value of 4 voltage criteria (Cornell, Sokolow-Lyon, Romhilt-Estes, and 12-lead QRS voltage) for detecting carriers of HC was investigated. In all subjects, the Romhilt-Estes (point score > or =4) criterion and 12-lead QRS voltage (> or =240 mm) were most sensitive (37% and 36%, respectively), with high specificity (95% each), resulting in the greatest accuracy (60% and 59%, respectively). Using these criteria, in subjects without echocardiographic evidence of left ventricular hypertrophy, voltage abnormalities were found in 22.6% of carriers and 4.7% of noncarriers (p <0.01). In conclusion, these findings suggest that the Romhilt-Estes and the 12-lead QRS voltage criteria may be the most accurate diagnostic definitions for HC on the basis of molecular genetic diagnoses. Furthermore, this study demonstrated that voltage abnormalities may be found in prehypertrophic carriers. Even when genetic testing becomes widely available, it will be difficult to make genetic diagnoses in all patients with HC because of its genetic heterogeneity. Therefore, understanding the diagnostic value of classic ECG voltage criteria may be important in detecting carriers, including those without left ventricular hypertrophy.
Adult↗
High incidence of sudden cardiac death with conduction disturbances and atrial cardiomyopathy caused by a nonsense mutation in the STA gene.
BACKGROUND: The STA gene encodes emerin and is one of the genes that is affected in Emery-Dreifuss muscular dystrophy (EDMD). Although it has been reported that EDMD caused by the STA gene mutation is associated with X-linked recessive inheritance, the genotype-phenotype correlations, with special reference to cardiac manifestations, are not well defined. METHODS AND RESULTS: We identified 16 carriers (7 male and 9 female) with a nonsense mutation in exon 6 of the STA gene in 2 EDMD families. Pacemakers were required for treatment of bradyarrhythmias in all 7 male carriers and in 2 of the 9 female carriers. In addition, 2 of the 9 female carriers displayed atrial fibrillation. In these 2 families, 3 males without pacemaker implantation, who were not tested genetically, had died suddenly. In these family members, the majority of carriers with the mutation had not been clinically diagnosed as having EDMD before genetic testing because of extremely mild or nonexistent skeletal myopathy. CONCLUSIONS: EDMD caused by this mutation is characterized by atypical clinical features and incomplete penetrance of the clinical phenotype and may result in serious cardiac complications, including sudden death. Approaches to preventing possible sudden death in carriers with the STA gene mutation require further study.
Adolescent↗
An effective case of growth hormone treatment on cartilage-hair hypoplasia.
Cartilage-hair hypoplasia (CHH) is an autosomal recessive metaphyseal chondrodysplasia characterized by severe short-limb short stature and hypoplastic hair. The responsible gene for CHH has been identified to be ribonuclease of mitochondrial RNA-processing (RMRP) gene. We examined RMRP genes of a 3-year-old Japanese CHH boy and his family and revealed a novel mutation: 20 bp duplication (TACTCTGTGAAGCTGAGGAC), in promoter region of maternal allele, at nucleotide -3 and a reported 218A>G point mutation in transcribed region of paternal allele. No treatment for CHH has been established so far. Growth hormone (GH) action has its effect on linear growth and on bone remodeling and homeostasis. Recently, GH has been used to improve severe short stature caused by not only GH deficiency (GHD) but also some skeletal dysplasias including achondroplasia. To improve severe short stature, we treated the patient with 0.175 mg kg-1 week-1 of GH for 7 years. His height was improved from -4.2 SD to -3.0 SD by 1 year of GH treatment. Following treatment had given positive effects continuously on his height to -2.6 SD by 3.1 years GH medication. Then, when he was 6 years old, surgical lengthening was performed and his height reached to -2.0 SD. After the surgery, we continued GH treatment. Additional GH treatment of 3.6 more years had kept his height to -2.0 SD. However, when he was 8 years old, because there was an interruption of GH treatment, the velocity of his height was obviously decreased comparing before and during the interruption, which was calculated 3.4 and 2.2 cm/year, respectively, and the SD score was decreased to -2.1 SD. This result of total 7 years of GH treatment suggested that GH treatment significantly improved his disturbed bone growth and had also positive efficacy to keep growth rate. This result implies the connection between GH signal and RMRP gene. Additionally, GH may be considered to be an efficient treatment for CHH.
Body Height↗
Differentiation between patients with takotsubo cardiomyopathy and those with anterior acute myocardial infarction.
BACKGROUND: There has not been a comparison of the electrocardiographic (ECG) finding of ST-segment elevation in the precordial leads in patients with takotsubo cardiomyopathy (TC) and those with anterior acute myocardial infarction (AMI), with regard to the location of the culprit lesion. METHODS AND RESULTS: The present study evaluated 18 patients with TC, and 85 with anterior AMI who were divided into 3 groups: group A had the culprit lesion proximal to both the first septal branch (S1) and the first diagonal branch (D1), group B had the culprit lesion proximal to either S1 or D1, and group C had the culprit lesion distal to both S1 and D1. In patients with TC, reciprocal ST-segment depression in the inferior leads was observed less frequently than in patients in groups A (p<0.0001) and B (p=0.0002), and abnormal Q waves and ST-segment elevation in the inferior leads were observed more frequently than in group A (p=0.0007, p=0.0057, respectively). The ECG findings in TC did not differ from those in group C. CONCLUSION: Electrocardiographic findings may differentiate TC from AMI with a proximal lesion of left anterior descending coronary artery, but not those with distal lesions.
Aged↗
A novel missense mutation in the myosin binding protein-C gene is responsible for hypertrophic cardiomyopathy with left ventricular dysfunction and dilation in elderly patients.
OBJECTIVES: We studied the clinical features of hypertrophic cardiomyopathy (HCM) caused by a novel mutation in the myosin binding protein-C (MyBP-C) gene in patients and family members of Japanese descent. BACKGROUND: Previous reports have demonstrated that the clinical features of HCM associated with mutations in the MyBP-C gene include late onset and a favorable clinical course. Recently, some mutations in genes encoding sarcomeric proteins have been reported to be a cause of dilated cardiomyopathy (DCM), as well as HCM. However, mutations of the MyBP-C gene have not been reported as a cause of DCM up to now. METHODS: We analyzed MyBP-C gene mutations in 250 unrelated probands with HCM and in 90 with DCM. We used electrocardiography (ECG) and echocardiography to determine clinical phenotypes. RESULTS: We identified 17 individuals in 8 families (7 HCM, 1 DCM) with an Arg820Gln mutation in the MyBP-C gene. Overall, 2 (40%) of 5 carriers age >70 years displayed "burnt-out" phase HCM, and one of them had been diagnosed as having DCM before genetic identification. The disease penetrance in subjects age >50 years was 70% by echocardiography and 100% by ECG, and that in those age <50 years was 40% and 50%, respectively. CONCLUSIONS: Elderly patients with Arg820Gln mutation may show "burnt-out" phase HCM, and patients with this mutation may be included among those diagnosed as having DCM. Screening of patients with DCM, as well as HCM, for this mutation is of significant importance because patients with this mutation may be diagnosed clinically as having DCM.
Adolescent↗
Autopsy findings in siblings with hypertrophic cardiomyopathy caused by Arg92Trp mutation in the cardiac troponin T gene showing dilated cardiomyopathy-like features.
BACKGROUND: Hypertrophic cardiomyopathy (HCM) is caused by mutations in the genes that encode sarcomeric proteins. Although some patients with HCM have shown dilated cardiomyopathy (DCM)-like features, the relationship between genotype and histologic findings is not well known. HYPOTHESIS: Family members with the same gene mutation may show the same histopathologic changes and clinical manifestations. METHODS: Siblings with HCM caused by an Arg92Trp mutation in the cardiac troponin T gene, showing DCM-like features, were examined. RESULTS: The patients were a 69-year-old woman and her 57-year-old brother who both died from congestive heart failure. Their autopsies revealed the same histopathologic findings in the heart. The anterior walls and interventricular septa of their hearts were replaced with extensive fibrosis and showed thinning. Myocyte hypertrophy, disarray, and thickened medial walls of the intramural coronary arteries were found. On electron microscopy, the number of mitochondria was seen to be increased and they formed many clusters. CONCLUSIONS: Patients with HCM caused by an Arg92Trp mutation in the cardiac troponin T gene may have the same histopathologic findings, which may result in DCM-like features.
Aged↗
Efficacy of growth hormone therapy for patients with skeletal dysplasia.
Most patients with skeletal dysplasia show severe short stature. Surgical therapy has been attempted to correct bone deformities, but therapy for improving their severe short stature has been rarely attempted. We undertook a clinical trial of growth hormone (GH) therapy for patients with skeletal dysplasia accompanying severe short stature caused by achondroplasia (ACH), hypochondroplasia (HCH), pseudoachondroplasia (PSACH), spondyloepiphyseal dysplasia congenita (SED), or Schmid type metaphyseal dysplasia (MD). This study examined the efficacy of GH therapy on height increase and change of height SD score over a 1-year period in patients with skeletal dysplasia and showed a short-term efficacy for skeletal dysplasia. In ACH, HCH, and MD, GH had a significant effect on height gain. However, PSACH and SED showed no height gain efficacy; in cases of PSACH, height SD score was worse after therapy. Severe adverse events were not observed except in one SED case, in which scoliosis worsened and height did not increase. For patients with skeletal dysplasia, GH therapy is moderately effective for height gain. It is ineffective in cases with severe spinal deformities, however; although bone growth was promoted, the ligaments and matrix were too weak to support muscle tonus and the effects of gravity, resulting in worsened kyphosis and lordosis. These results clarify why GH therapy is ineffective for height gain. The pathogenic genes of skeletal dysplasia have recently been detected and consequently changes in bone formation have been investigated in detail. Careful consideration of indications for therapy and cautious observation during therapy are crucial when attempting to treat advanced bone deformities.
Achondroplasia↗
Q-T peak dispersion in congenital long QT syndrome: possible marker of mutation of HERG.
Congenital long QT syndrome (LQTS) is caused by mutations in various cardiac potassium or sodium channel genes, with 6 different genotypes thus far identified. However, it is unknown whether these genotypes can be differentiated by QT variables. The electrocardiograms obtained from 16 patients with a mutation in KCNQ1 (LQT1), 7 patients with a mutation in HERG (LQT2) and 20 control subjects were analyzed. The corrected QT interval (QTc), Q-T peak interval (QTpc) and dispersion of QTc or QTpc were measured in 6 precordial leads. The corrected interval from T peak to T end (Tpec) was measured in lead V(5). The maximum QTc, QTc dispersion, and Tpec were significantly increased in the LQT1 and LQT2 patients than in the controls. However, there were no significant differences in these indices between the LQT1 and LQT2 patients. In contrast, QTpc dispersion was significantly increased in the LQT2 patients (78+/-25 ms) compared with the LQT1 patients (29+/-15 ms) and controls (26+/-19 ms). These results suggest that increased lag of the peak of the T wave in each precordial lead (QTpc dispersion) may be a possible index to differentiate LQTS patients with HERG mutation from those with KCNQ1 mutation.
Adult↗
Reduction of hemolysis without reoperation following mitral valve repair.
Hemolytic anemia following mitral valve repair and annular ring placement is uncommon compared with mitral valve replacement. A 60-year-old man, who had undergone mitral valve repair with a Duran ring, developed hemolytic anemia and needed a blood transfusion. Transesophageal echocardiography revealed a paravalvular mitral regurgitation jet colliding with the Duran ring. Most cases of severe hemolysis after mitral valve repair have undergone reoperation, but in the present case study, the hemolysis after mitral valve repair reduced without the need for reoperation, although the paravalvular mitral regurgitation jet continued to collide with the Duran ring.
Anemia, Hemolytic↗
Insulin-like growth factor-1 rescues the mutated FGF receptor 3 (G380R) expressing ATDC5 cells from apoptosis through phosphatidylinositol 3-kinase and MAPK.
UNLABELLED: An activated mutation in the FGFR3 gene causes ACH. To examine the effects of IGF-1, which is an important mediator of GH, on apoptosis, we analyzed a chondrogenic cell line expressing the FGFR3 mutants. Our findings that IGF-1 prevented the apoptosis through PI3K and MAPK pathways may explain how GH treatment improves the disturbed bone growth in ACH. INTRODUCTION: Achondroplasia (ACH), which is caused by a point mutation of the fibroblast growth factor receptor 3 (FGFR3) gene in the transmembrane domain (G380R), is one of the most common genetic forms of dwarfism. Recently, using a chondrogenic cell line, ATDC5, we have showed that the constitutively active FGFR3 mutants induced an apoptosis of chondrocytes. We have also reported that growth hormone (GH) treatment increased the growth rate in achondroplasia in parallel with the increment of serum levels of insulin-like growth factor (IGF)-1, suggesting an important role of IGF-1 in skeletal development. In this study, to clarify the mechanism by which GH treatment improved the phenotype of ACH patients, we examined the possible effects of IGF-1 on an apoptosis induced by FGFR3 mutant in ATDC5. MATERIALS AND METHODS: Using adenovirus vector, wildtype or mutant FGFR3 (G380R) was introduced into ATDC5. Analysis of apoptosis was estimated by TUNEL assay. Expression levels of apoptosis-related genes and activation of signaling molecules were analyzed by immunoblot. RESULTS: MTT assay showed that the cell number was reduced in ATDC5 cells expressing the mutant FGFR3 (G380R; ATDC5-mtR3 cells), suggesting that ATDC5-mtR3 cells might fall into apoptosis. IGF-1, which is an important mediator of GH, restored cell proliferation and reduced apoptosis in ATDC5-mtR3 cells. IGF-1 also decreased the ratio of Bax/Bcl-2 in the cells. To investigate which signaling cascade is responsible for antiapoptotic effects of IGF-1, we examined the role of phosphatidylinositol 3-kinase (PI3K) and MAPK in ATDC5-mtR3 cells. Specific inhibitors of PI3K or MAPK blocked the antiapoptotic effects of IGF-1 in ATDC5-mtR3 cells. CONCLUSIONS: Our findings, showing IGF-1 prevents the apoptosis induced by FGFR3 mutation through the PI3K pathway and MAPK pathway, explain the mechanisms by which GH treatment improves the disturbed bone growth in ACH.
Animals↗
In-hospital outcome in octogenarians with acute coronary syndrome undergoing emergent coronary angiography.
Very elderly patients have higher mortality rates than younger patients after acute coronary syndrome (ACS). However, the mechanism by which increasing age contributes to such mortality remains unclear. In addition, the efficacy and safety of invasive coronary procedures for octogenarians with ACS have not been well established. We compared the clinical characteristics and in-hospital outcome of 193 octogenarians (mean age, 83 years) with those of 1,462 younger patients (mean age, 64 years) with ACS who underwent emergent coronary angiography. Octogenarians included a greater number of females, had higher rates of cerebrovascular disease and multivessel disease, a higher Killip class, a higher Forrester class, and lower rates of smoking, diabetes, and hypercholesterolemia than the younger subjects. Interventions, including percutaneous transluminal coronary angioplasty (PTCA) and coronary artery bypass grafting (CABG), were performed less frequently in octogenarians than in younger patients (88.0% versus 90.8%). The procedural success rate in octogenarians did not differ from that in younger patients. However, the in-hospital mortality rate for the octogenarians was about three times higher than for the younger patients (19.2% versus 6.9%). Multivariate analysis revealed that the predictors of in-hospital mortality in the octogenarians were a higher Killip class and a higher Forrester class. Octogenarians with ACS had fewer coronary risk factors and a similar success rate for the intervention, but had more greatly impaired hemodynamics and higher in-hospital mortality than the younger patients. Therefore, impaired myocardial reserve may contribute to a large portion of in-hospital deaths in octogenarians with ACS.
Aged↗
Chronologic electrocardiographic changes in patients with hypertrophic cardiomyopathy associated with cardiac troponin 1 mutation.
BACKGROUND: Deletion of lysine 183 (K183del) in the cardiac troponin I (cTnI) gene is one of the mutations that causes hypertrophic cardiomyopathy (HCM). However, the phenotypic expression of this mutation has not been well established. METHODS AND RESULTS: We analyzed 10 probands with HCM associated with a K183del in the cTnI gene, as well as their family members. Forty-seven of these 80 subjects were found to be carriers and 33 were noncarriers. In the carrier subjects, electrocardiogram (ECG) abnormalities were initially noted during the early teenage years preceding echocardiographic abnormalities. Abnormal Q waves were found first and most frequently compared with other ECG abnormalities. Abnormal Q waves were frequently observed in leads II, III, aVF, V5, and V6 in teenage patients, whereas they were observed in many leads in patients >20 years old. The youngest of the 11 patients who had sudden cardiac death among studied pedigrees was a 14-year-old boy. CONCLUSIONS: These results suggest that the first phenotypic manifestation in patients with HCM associated with a K183del mutation in the cTnI gene is abnormal Q waves in leads II, III, aVF, V5, and V6 during the early teenage years. To prevent sudden death in family members of patients with this mutation, it may be necessary to genetically diagnose it before age 10 years and to pay careful attention to any development of abnormal Q waves.
Adolescent↗
Effects of gender on the number of diseased vessels and clinical outcome in Japanese patients with acute coronary syndrome.
It has been reported that women with acute myocardial infarction (AMI) have a higher short-term mortality rate than men, but the reason is unclear and it is not known if it also applies to unstable angina pectoris (UAP). In addition, most previous studies have not presented angiographic findings. In the present study, the findings from 1,408 patients with AMI (group A: 361 women, 1,047 men) and 332 patients with UAP (group B: 103 women, 229 men) who underwent coronary angiography within 30 days of onset were analyzed. In both groups, the women were older and had a higher rate of hypertension and a lower rate of smoking than the men. There was no significant difference in Killip class or the number of diseased vessels between the women and men in both groups. Interventions (coronary angioplasty and coronary artery bypass grafting) were performed less frequently in the women than in the men (87.2% vs 91.8%, p=0.04) in group A, but not in group B (80.6% vs 81.2%, NS). In both groups, the overall mortality rate during hospitalization was higher in women than in men (group A: 14.4% vs 7.4%, p<0.0001, group B: 7.8% vs 1.7%, p=0.007). Multivariate analysis revealed that female gender was an independent predictor of in-hospital mortality in group B (odds ratio (OR): 6.4, 95% confidence interval (CI) 1.1-37.0, p=0.04), but not in group A (OR: 1.7, 95%CI 0.98-2.9, p=0.06). The independent predictors of in-hospital mortality, other than female gender were age, prior congestive heart failure, prior cerebrovascular disease and a higher Killip class in group A, and in both groups a higher number of diseased vessels. In conclusion, Japanese women with acute coronary syndromes present with similar angiographic findings and hemodynamics, but have a higher in-hospital mortality than male patients. Our results suggest that older age may be a potential explanation for the higher in-hospital mortality in women with AMI, but female gender itself may be an important predictor for it among those with UAP.
Acute Disease↗
Cardiac sympathetic nerve activity in patients with hypertrophic cardiomyopathy with malignant ventricular tachyarrhythmias.
BACKGROUND: Malignant ventricular tachyarrhythmia (VT) and sudden death are serious events in hypertrophic cardiomyopathy (HCM). However, the pathophysiology of this condition is not well understood. The objective of this study was to evaluate the relationship between cardiac sympathetic nerve activity and the occurrence of VT in HCM patients. Methods and results We studied iodine 123 metaiodobenzylguanidine scintigraphy and 24-hour ambulatory electrocardiographic monitoring in 44 HCM patients, 15 with VT (group A) and 29 without VT (group B). With planar I-123 metaiodobenzylguanidine imaging, the heart-to-mediastinum ratio for early and delayed acquisition and washout rate were calculated. Polar maps of left ventricular myocardium were divided into 20 segments, and the SD of uptake and washout rate in 20 segments were calculated as indices of regional variation. The global washout rate was significantly higher in group A than in group B (26.8 +/- 6.4% vs 17.4 +/- 5.7%, P <.0001), although other parameters including heterogeneity indices did not differ. The logistic multiple regression analysis also determined that washout rate was the most powerful predictor of VT in patients with HCM. CONCLUSIONS: The occurrence of malignant VT in HCM may be associated with global cardiac sympathetic nerve activity rather than with the heterogeneity of this activity.
3-Iodobenzylguanidine↗
A rare type of alternating bundle branch block in a patient with cardiac sarcoidosis--a case report.
The authors report a rare type of alternating bundle branch block observed in a patient with cardiac sarcoidosis. Not only alternation of complete right and left bundle branch block but also narrow QRS complexes were observed on electrocardiogram. The mechanism of these unusual findings is briefly discussed.
Adult↗