Search PubMed⌕ Search

Biomedical subjects

Masanobu Yamada

Publications and source records attributed to Masanobu Yamada.

At least 19 recordsLinked to original sources

Identification of nesfatin-1 as a satiety molecule in the hypothalamus.

The brain hypothalamus contains certain secreted molecules that are important in regulating feeding behaviour. Here we show that nesfatin, corresponding to NEFA/nucleobindin2 (NUCB2), a secreted protein of unknown function, is expressed in the appetite-control hypothalamic nuclei in rats. Intracerebroventricular (i.c.v.) injection of NUCB2 reduces feeding. Rat cerebrospinal fluid contains nesfatin-1, an amino-terminal fragment derived from NUCB2, and its expression is decreased in the hypothalamic paraventricular nucleus under starved conditions. I.c.v. injection of nesfatin-1 decreases food intake in a dose-dependent manner, whereas injection of an antibody neutralizing nesfatin-1 stimulates appetite. In contrast, i.c.v. injection of other possible fragments processed from NUCB2 does not promote satiety, and conversion of NUCB2 to nesfatin-1 is necessary to induce feeding suppression. Chronic i.c.v. injection of nesfatin-1 reduces body weight, whereas rats gain body weight after chronic i.c.v. injection of antisense morpholino oligonucleotide against the gene encoding NUCB2. Nesfatin-1-induced anorexia occurs in Zucker rats with a leptin receptor mutation, and an anti-nesfatin-1 antibody does not block leptin-induced anorexia. In contrast, central injection of alpha-melanocyte-stimulating hormone elevates NUCB2 gene expression in the paraventricular nucleus, and satiety by nesfatin-1 is abolished by an antagonist of the melanocortin-3/4 receptor. We identify nesfatin-1 as a satiety molecule that is associated with melanocortin signalling in the hypothalamus.

Animals↗

Loss of consciousness and hypokalemia in an elderly man with a mutation of the thiazide-sensitive Na-Cl cotransporter gene.

An 80-year-old man was referred to our department for evaluation of repetitive loss of consciousness and faintness with hypokalemia. He had relatively low blood pressure, hypomagnesemia, hypocalciuria and chondrocalcinosis in the knee, clinically suggesting Gitelman's syndrome. A renal clearance study could not be carried out due to the patient's age and complications of the heart. Sequence analysis of the gene of thiazide-sensitive Na-Cl cotransporter (TSC) showed a heterozygous missense mutation from C to T at 1712 base pairs from the translation start site, with resultant changes in codon 569 from alanine to valine (A569V). Treatment with oral administration of potassium chloride improved all the symptoms. Although Gitelman's syndrome has been considered to be autosomal recessive, cases of only heterozygous mutation detected have recently been reported. Therefore, the mutation found in this patient may be responsible for Gitelman's syndrome.

Aged, 80 and over↗

Mouse sterol response element binding protein-1c gene expression is negatively regulated by thyroid hormone.

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1-6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (-574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-alpha/thyroid hormone receptor-beta heterodimer bound to Site2, but retinoid X receptor-alpha/liver X receptor- heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-beta recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.

Animals↗

[Hypothyroidism].

Explore the source record for details and available documents.

Congenital Hypothyroidism↗

Prolactin secretion in mice with thyrotropin-releasing hormone deficiency.

The physiological roles of TRH in pituitary lactotrophs, particularly during lactation, remain unclear. We studied the prolactin (PRL) status, including serum PRL and PRL mRNA levels in the pituitary, in nonlactating and lactating TRH-deficient (TRH(-/-)) mice with a rescue study with thyroid hormone and TRH. We found that, as reported previously for male TRH(-/-) mice, neither the morphology of the lactotrophs, PRL content in the pituitary, nor the serum PRL concentration was changed in nonlactating female TRH(-/-) mice. However, concurrent hypothyroidism induced a mild decrease in the PRL mRNA level. In contrast, during lactation, the serum PRL level in TRH(-/-) mice was significantly reduced to about 60% of the level in wild-type mice, and this was reversed by prolonged TRH administration, but not by thyroid hormone replacement. The PRL content and PRL mRNA level in the mutant pituitary during lactation were significantly lower than those in wild-type mice, and these reductions were reversed completely by TRH administration, but only partially by thyroid hormone replacement. Despite the low PRL levels, TRH(-/-) dams were fertile, and the nourished pups exhibited normal growth. Furthermore, the morphology of the pituitary was normal, and high performance gel filtration chromatography analysis of the PRL molecule revealed no apparent changes. We concluded that 1) TRH is not essential for pregnancy and lactation, but is required for full function of the lactotrophs, particularly during lactation; and 2) the PRL mRNA level in the pituitary is regulated by TRH, both directly and indirectly via thyroid hormone.

Animals↗

Expression of thyroid hormone receptor isoforms down-regulated by thyroid hormone in human medulloblastoma cells.

The role of thyroid hormone (T3) in the regulation of growth and development of the central nervous system including the cerebellum has been well established. However, the effects of thyroid hormone on malignant tumors derived from the cerebellum remain poorly understood. Our analysis mainly focused on expression levels of TR isoforms and the effects of thyroid hormone in human medulloblastoma HTB-185 cells. Northern blot analysis revealed TRalpha2 mRNA but not TRalpha1, beta1 or beta2 mRNA in the cell. The TRalpha1 and TRbeta1 mRNAs were detected only by RT-PCR method and TRbeta2 was not expressed. Incubation of T3 for 24 h decreased TRalpha1, TRalpha2 and TRbeta1 mRNA. Addition of actinomycin D caused an acute increase in the basal TR mRNA levels and the rate of decrease of all kinds of TR isoform mRNA was accelerated in the T3-treated groups compared to controls, indicating that the stability of TR mRNA was affected by T3. Incubation with cycloheximide also blocked a decrease in TR mRNA levels in the T3-treated HTB-185 cells suggesting that down-regulation of TR mRNA required the synthesis of new protein. Our data provide novel evidence for the expression of TRs down-regulated by T3 in HTB-185 cells, suggesting that TR expression is post-transcriptionally regulated by T3 at the level of RNA stability.

Brain Neoplasms↗

[Resistance to thyroid hormone].

Resistance to thyroid hormone is a syndrome involving reduced responsiveness of target tissues to thyroid hormone. Most cases involve mutations of the thyroid hormone receptor beta gene. Since many patients demonstrate tachycardia, goiter and elevated serum thyroid hormone levels, some patients have been misdiagnosed with Graves' disease, and nearly one third of patients are being treated inappropriately. It is important to keep this diagnosis in mind when a patient with elevated thyroid hormone level accompanied by normal or slightly increased TSH levels (SITSH) is encountered. Therapy with TRIAC has been used in several patients.

Biomarkers↗

Dominant role of thyrotropin-releasing hormone in the hypothalamic-pituitary-thyroid axis.

Hypothalamic thyrotropin-releasing hormone (TRH) stimulates thyroid-stimulating hormone (TSH) secretion from the anterior pituitary. TSH then initiates thyroid hormone (TH) synthesis and release from the thyroid gland. Although opposing TRH and TH inputs regulate the hypothalamic-pituitary-thyroid axis, TH negative feedback is thought to be the primary regulator. This hypothesis, however, has yet to be proven in vivo. To elucidate the relative importance of TRH and TH in regulating the hypothalamic-pituitary-thyroid axis, we have generated mice that lack either TRH, the beta isoforms of TH receptors (TRbeta KO), or both (double KO). TRbeta knock-out (KO) mice have significantly higher TH and TSH levels compared with wild-type mice, in contrast to double KO mice, which have reduced TH and TSH levels. Unexpectedly, hypothyroid double KO mice also failed to mount a significant rise in serum TSH levels, and pituitary TSH immunostaining was markedly reduced compared with all other hypothyroid mouse genotypes. This impaired TSH response, however, was not due to a reduced number of pituitary thyrotrophs because thyrotroph cell number, as assessed by counting TSH immunopositive cells, was restored after chronic TRH treatment. Thus, TRH is absolutely required for both TSH and TH synthesis but is not necessary for thyrotroph cell development.

Animals↗

Cross-talk between thyroid hormone receptor and liver X receptor regulatory pathways is revealed in a thyroid hormone resistance mouse model.

Hypercholesterolemia is found in patients with hypothyroidism and resistance to thyroid hormone. In this study, we examined cholesterol metabolism in a thyroid hormone receptor beta (TR-beta) mutant mouse model of resistance to thyroid hormone. Whereas studies of cholesterol metabolism have been reported in TR-beta knock-out mice, generalized expression of a non-ligand binding TR-beta protein in this knock-in model more fully recapitulates the hypothyroid state, because the hypothyroid effect of TRs is mediated by the unliganded receptor. In the hypothyroid state, a high cholesterol diet increased serum cholesterol levels in wild-type animals (WT) but either did not change or reduced levels in mutant (MUT) mice relative to hypothyroidism alone. 7alpha-Hydroxylase (CYP7A1) is the rate-limiting enzyme in cholesterol metabolism and mRNA levels were undetectable in the hypothyroid state in all animals. triiodothyronine replacement restored CYP7A1 mRNA levels in WT mice but had minimal effect in MUT mice. In contrast, a high cholesterol diet markedly induced CYP7A1 levels in MUT but not WT mice in the hypothyroid state. Elevation of CYP7A1 mRNA levels and reduced hepatic cholesterol content in MUT animals are likely because of cross-talk between TR-beta and liver X receptor alpha (LXR-alpha), which both bind to a direct repeat + 4 (DR+4) element in the CYP7A1 promoter. In transfection studies, WT but not MUT TR-beta antagonized induction of this promoter by LXR-alpha. Electromobility shift analysis revealed that LXR/RXR heterodimers bound to the DR+4 element in the presence of MUT but not WT TR-beta. A mechanism for cross-talk, and potential antagonism, between TR-beta and LXR-alpha is proposed.

Animals↗

Isolation and characterization of a transcriptional cofactor and its novel isoform that bind the deoxyribonucleic acid-binding domain of peroxisome proliferator-activated receptor-gamma.

Using the DNA-binding domain (DBD) and hinge region of human peroxisome proliferator-activated receptor (PPAR)-gamma as bait in yeast two-hybrid screen, we isolated partial cDNA identical with that of the C terminal of KIAA1769. KIAA1769 encodes a 2080-amino acid protein (molecular mass, 231 kDa) that was recently identified to interact with PPARalpha and termed PPARalpha-interacting cofactor 285 (here referred to as PPARgamma-DBD-interacting protein 1 (PDIP1)-alpha). PDIP1 mRNA was expressed in 3T3-L1 adipocytes and THP-1 macrophages. We also identified the expression of the N terminal extended form of PDIP1alpha (referred to as PDIP1beta) consisting of 2649 amino acids (295 kDa) in human cultured cell lines by RT-PCR, and 5' rapid amplification of cDNA ends. Ribonuclease protection assay revealed that PDIP1beta mRNA was expressed more abundantly than PDIP1alpha mRNA. The C-terminal region of PDIP1 directly binds DBD of PPARgamma, and multiple LXXLL motifs in PDIP1 were not required for the interaction. PDIP1alpha and -beta similarly enhanced PPARgamma-mediated transactivation in transfection assays and short interfering RNA targeting PDIP1 mRNA significantly reduced transactivation by PPARgamma. No potent intrinsic activation domain was identified in either PDIP1 isoforms in mammalian one-hybrid assays, and mutation of all LXXLL motifs did not affect enhancement of PPARgamma-mediated transactivation. PDIP1alpha and -beta similarly augmented transactivation by PPARalpha, PPARdelta, thyroid hormone receptor (TR)-alpha1, TRbeta1, and retinoid X receptor-alpha. PDIP1alpha also enhanced estrogen receptoralpha- and androgen receptor-mediated transactivation, whereas PDIP1beta did not. PDIP1alpha showed receptor-specific synergism with activation function-2-interacting coactivators in PPARgamma- and TRbeta1-mediated transactivation. Together, PDIP1 might function as a transcriptional cofactor for a broad range of nuclear receptors, possibly in collaboration with specific activation function-2 interacting coactivators.

3T3 Cells↗

Thyrotropin-releasing hormone (TRH) specific interaction between amino terminus of P-Lim and CREB binding protein (CBP).

P-Lim (Lhx3a) is a LIM homeodomain transcription factor essential for pituitary development and motor neuron specification in mice. The Lhx3 gene encodes two isoforms, which differ in their amino (N) termini, Lhx3a and 3b. The P-Lim DNA binding site on the glycoprotein hormone alpha subunit (alpha-GSU) gene promoter is conserved in mammals. P-Lim plays a pivotal role in mediating thyrotropin-releasing hormone (TRH) signaling by binding CREB binding protein (CBP), as we have reported previously. Here, we demonstrate that P-Lim (Lhx3a) but not Lhx3b can mediate TRH signaling and bind to CBP. Moreover, TRH specifically induces P-Lim-CBP binding through the N-termini of P-Lim. We also found that the protein kinase C (PKC) phosphorylation site within the N-terminus of P-Lim is responsible for the P-Lim-CBP binding suggesting that the TRH signaling pathway phosphorylates P-Lim. These studies have elucidated the molecular mechanism by which TRH stimulates alpha-GSU gene expression.

Animals↗

Unliganded RXR acts as an inhibitory factor on troglitazone-induced activation.

Troglitazone (TZ), a thiazolidinedione derivative, is a specific ligand for the peroxisome proliferator-activated receptor (PPAR) gamma and improves insulin sensitivity. PPARgamma regulates the expression of genes by binding to PPAR response element in promoter regions of regulator genes as heterodimers with a retinoid X receptor (RXR). We report here that PPARgamma activation by TZ depends on the expression levels of RXR. A transient transfection study in CV-1 cells revealed that the activation by TZ was suppressed by increasing amounts of expression of RXR, but not PPARgamma. Northern blot analysis revealed that PPARgamma and RXR were not expressed in CV-1 cells, and TZ did not induce PPARgamma or RXR mRNA in CV-1 cells indicating that RXR suppression is not related to these endogenous receptor expressions. Electrophoretic mobility shift assay revealed that the increasing amount of RXR did not compete with the DNA binding of the PPARgamma/RXR heterodimer in the presence or absence of TZ. Transfected co-activators enhanced the TZ-dependent gene transcription, and this activation was inhibited by excessive amounts of RXR, indicating that unliganded RXR may recruit the specific coactivators from the PPARgamma/RXR heterodimer.

Animals↗