Search PubMed⌕ Search

Biomedical subjects

M W Gray

Publications and source records attributed to M W Gray.

At least 145 records · Page 8Linked to original sources
PubMed1980

Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

Animals↗
PubMed1980

Organization and expression of the mitochondrial genome of plants I. The genes for wheat mitochondrial ribosomal and transfer RNA: evidence for an unusual arrangement.

We show here that mitochondrial-specific ribosomal and transfer RNAs of wheat (Triticum vulgare Vill. [Triticum aestivum L.] var. Thatcher) are encoded by the mitochondrial DNA (mtDNA). Individual wheat mitochondrial rRNA species (26S, 18S, 5S) each hybridized with several mtDNA fragments in a particular restriction digest (Eco RI, Xho I, or Sal I). In each case, the DNA fragments to which 18S and 5S rRNAs hybridized were the same, but different from those to which 26S rRNA hybridized. From these results, we conclude that the structural genes for wheat mitochondrial 18S and 5S rRNAs are closely linked, but are physically distant from the genes for wheat mitochondrial 26S rRNA. This arrangement of rRNA genes is clearly different from that in prokaryotes and chloroplasts, where 23S, 16S and 5S rRNA genes are closely linked, even though wheat mitochondrial 18S rRNA has previously been shown to be prokaryotic in nature. The mixed population of wheat mitochondrial 4S RNAs (tRNAs) hybridized with many large restriction fragments, indicating that the tRNA genes are broadly distributed throughout the mitochondrial genome, with some apparent clustering in regions containing 18S and 5S rRNA genes.

DNA Restriction Enzymes↗
PubMed1980

Nucleotide sequences of wheat-embryo cytosol 5-S and 5.8-S ribosomal ribonucleic acids.

The nucleotide sequences of wheat embryo 5.8-S and 5-S rRNAs have been determined with the use of several techniques, including classic analysis of oligonucleotides generated by ribonuclease T1 and resolution on gels of terminally labelled RNA partially degraded with ribonucleases or with chemical reagents. The sequence of wheat embryo 5.8-S rRNA was found to be (formula: see text). This sequence is compared to 5-S rRNA sequences previously published for wheat and several other angiosperms.

Base Sequence↗
PubMed1979

The ribosomal RNA of the trypanosomatid protozoan Crithidia fasciculata: physical characteristics and methylated sequences.

When extracted and analyzed under conditions which maintain noncovalently associated RNA-RNA complexes, the bulk cellular RNA of Crithidia fasciculata contains species of apparent molecular weights 1.3, 0.825, 0.08, 0.065, and 0.045 x 10(6) in addition to 5S rRNA and tRNA. Heat denaturation results in the disappearance of the 1.3 x 10(6) dalton RNA and the appearance of three new species having molecular weights of 0.67, 0.575, and 0.059 x 10(6). In addition, the apparent molecular weight of the 0.825 x 10(6) dalton component is reproducibly lowered to 0.81 x 10(6) after heat treatment. With the exception of tRNA, all of the RNA species are present in close to equimolar amounts in either undenatured or heat-denatured C. fasciculata bulk cellular RNA. On the basis of previous observations on the ribosomal RNA of the closely related organism, Crithidia oncopelti (Spencer, R. & Cross, G.A.M. (1976) J. Gen. Microbiol. 93, 82-88), the 1.3 and 0.825 x 10(6) dalton RNA's are considered to be components of the large and small subunits, respectively, of C. fasciculata ribosomes, but the subunit localization of the other RNA's described here has not yet been determined. O2'-Methylnucleosides account for about 1.4 mol% of the total nucleoside constituents of unfractionated C. fasciculata rRNA. Quantitative analysis suggests that the rRNA molecules in a C. fasciculata ribosome contain a total of 95-100 O2'-methyl groups, distributed in 80-85 Nm-Np sequences (including four 'hypermodified' Nm-Np, each containing a modification of a base or base-sugar linkage in addition to sugar methylation), six different Nm-Nm-Np sequences, and one Nm-Nm-Nm-Np sequence. While the specific pattern of O2'-methylation in the rRNA of C. fasciculata is distinct, both qualitatively and quantitatively, from the pattern observed in other organisms, Crithidia rRNA does contain certain 'universal' O2'-methylated sequences which appear to have been extensively conserved in evolution. The base-methylated nucleoside, N6,N6-dimethyladenosine (m26A), has been isolated from both C. fasciculata and wheat embryo rRNA in the form of the alkali-resistant dinucleotide, m26A-m26Ap. This dinucleotide and its enzymatic degradation products have been characterized by examination of their ultraviolet absorption spectra and electrophoretic and chromatographic properties.

Animals↗
PubMed1977

Isolation and characterization of 32P-labeled mitochondrial and cytosol ribosomal RNA from germinating wheat embryos.

With the aim of preparing highly labeled material, the incorporation of [32P]-orthophosphate into mitochondral and cytosol ribosomal RNA was examined in germinating wheat embryos. Nucleic acids were extracted from mitochondria and from post-mitochondrial supernatant (cytosol) prepared from homogenates of viable embryos (8g) imbibed for 24h in a medium containing [32P]orthophosphate (100mCi). High-molecular-weight ribosomal RNA was selectively precipitated in the presence of 3M NaCl and was further resolved on sucrose density gradients and polyacrylamide gels. Both the mitochondrial and cytosol NaCl-insoluble RNA fractions were found to contain two major radioactive components, corresponding to the large (26S) and small (18S)rRNA species. On non-denaturing gels, these species had apparent molecular weights of 1.3 and 0.67 million daltons (cytosol) and 1.3 and 0.75 million daltons (mitochondrial). The individual, purified [32P]rRNA components (isolated from sucrose gradients) had specific activities of 2--3-10(6) cpm/A260 unit, and were suitable for analysis of nucleotide composition and sequence. By hydrolyzing the individual [32P]rRNA specimens with purified snake venom phosphodiesterase and resolving the products by two-dimensional paper chromatography, it was possible to determine the specific activities (cpm/micronmol) of the four major 5'-nucleotide constituents. The results indicated that there had been no differential 32P-labeling of the nuclear and mitochondrial pools of ribonucleoside 5'-triphosphates (rNTP) during the 24 h imbibition period; however, as previously observed in this system (Lau, R.Y., Kennedy, T.D. and Lane, B.G. (1974) Can. J. Biochem. 52, 1110--1123), there had been unequal 32P-labeling of the individual rNTPs in both the mitochondria and nucleus. The relative specific activities of the 5'-nucleotide constituents of the mitochondrial and cytosol rRNA species were essentially the same, and in the order pA congruent to pU greater than pG greater than pC. By making suitable corrections for these differences in specific activity, the nucleotide composition of each of the [32P]rRNA specimens could be calculated...

Cell Fractionation↗
PubMed1977

Wheat embryo mitochondrial 18S ribosomal RNA: evidence for its prokaryotic nature.

We present a catalog of sequences of oligonucleotides produced by T1 ribonuclease digestion of 32P-labeled small-ribosomal-subunit RNA ("18S rRNA) isolated from purified wheat embryo mitochondria. This catalog is compared to catalogs published for prokaryotic and chloroplast 16S rRNAs and to preliminary results for wheat cytosol 18S rRNA. These comparisons indicate that: (1) wheat mitochondrial 18S rRNA is clearly prokaryotic in nature, showing significantly more sequence homology with 16S rRNAs than can be expected to arise by chance (p less than 0.000001); (2) shared oligonucleotide sequences include an especially high proportion of those identified as conserved in the evolution of prokaryotic rRNAs; and (3) wheat embryo mitochondrial and cytosol 18S rRNAs retain no more, and perhaps less, than the minimum sequence homology detectable by this sensitive method. These results argue in favor of an endosymbiotic origin for mitochondria.

Base Sequence↗
PubMed1977

Hypermodified alkali-stable dinucleotide sequences in each of the high-molecular-weight (26S and 18S) ribosomal RNA species of wheat.

Two hypermodified, alkali-stable dinucleotide sequences, each containing a base modification in addition to sugar methylation, are known to be present in wheat embryo 26S + 18S rRNA (Gray, M.W. (1974) Biochemistry 13, 5453-5463). Quantitative analysis of unfractionated 26S + 18S rRNA had suggested that each of these sequences (Cm-psi p and psi m-Ap, where Cm=O2'-methylcytidine and psi m-O2'-methylpseudouridine) was present in either the 18S or the 26S rRNA species, but not the both, at a frequency of not more than once per chain. In the study reported here, the individual 32P-labeled 18S and 26S rRNA species were isolated from viable wheat embryos germinated in the presence of [32P]orthophosphate. From analyses of phosphodiesterase and alkaline hydrolysates of the separated [32P]RNAs, we conclude that psi m-Ap is confined to wheat cytosol 18S rRNA, whereas Cm-psi p is localized in wheat cytosol 26S rRNA. The presence of psi m in the 18S rRNA of wheat stands in contrast with the situation in animal cells, where this hypermodified nucleoside is located in the 28S rRNA (Khan, M.S.N. & Maden, B.E.H. (1976) J. Mol. Biol. 101, 235-254).

Cytosol↗
PubMed1976

Structural analysis of O2'-methyl-5-carbamoylmethyluridine, a newly discovered constituent of yeast transfer RNA.

A compound tentatively identified as O2-methyl-5-carboxymethyluridine (cm5Um) was recently isolated in this laboratory from bulk yeast transfer RNA (Gray, M. W. (1975), Can, J. Biochem. 53, 735-746). Alkaline hydrolysis of yeast tRNA releases this nucleoside as part of an alkali-stable dinucleotide, cm5Um-Ap, from which sufficient cm5Um was prepared in the present investigation for a detailed examination of its properties. The ultraviolet absorption spectra and chromatographic and electrophoretic properties of cm5Um were consistent with the proposed structure, which was confirmed by characterization of the base and sugar moieties as 5-carboxymethyluracil and 2-O-methylribose, respectively. Snake venom hydrolysis of yeast tRNA releases cm5Um in the form of a carboxyl-blocked 5'-nucleotide, designated pU-2. Identification of the alkali-labile blocking group in pU-2 as an amide was based on quantitative assay for ammonia released upon acid hydrolysis of the corresponding nucleoside, U-2, and by chromatographic comparison of U-2 with the semisynthetic methyl ester and amide derivatives of cm5Um (mcm5Um and ncm5Um, respectively). Quantitative analysis has indicated that ncm5Um may be confined to a single species of yeast tRNA. In view of the unique localization (the "Wobble" position of the anticodon sequence) and coding properties (pairing with A but not with G) of other cm5U derivatives in transfer RNA, the dinucleotide cm5Um-Ap may be derived from the first two positions of the anticodon sequence of a yeast tRNA species recognizing an NUA codon. This predicts that O2-methyl-5-carbamoylmethyluridine will be found in an isoleucine, leucine, or valine isoacceptor.

Ammonia↗
PubMed1976

O2'-Methylinosine, a constituent of the ribosomal RNA of Crithidia fasciculata.

A novel nucleoside, O2'-methylinosine (Im), has been identified as a constituent of the ribosomal RNA of Crithidia fasciculata, a hemoflaggelate protozoan. The nucleoside is released as part of an alkali-stable dinucleotide, Im-Up, by alkaline hydrolysis of Crithidia rRNA, and as a 5'-nucleotide, pIm, by snake venom hydrolysis of the same RNA. The Im-containing derivatives isolated from Crithidia rRNA were characterized by comparison with marker compounds prepared by chemical deamination of the corresponding adenosine analogues. O2'-Methylinosine prepared from either natural Im-Up or natural pIm had the same ultraviolet absorption spectra and chromatographic properties as marker Im. Characterization of the base and sugar components of Im as hypoxanthine and 2-O-methylribose, respectively, provided final confimration of structure. Control experiments have eliminated the possibility that Im arises from O2'-methyladenosine (Am), a known constituent of ribosomal RNA, by chemical or enzymatic deamination during hydrolysis of Crithidia rRNA.

Chromatography, Paper↗
PubMed1976

Modified 5'-nucleotides resistant to 5'-nucleotidase: isolation of 3-(3-amino-3-carboxypropyl) uridine 5'-phosphate and N2, N2-dimethylguanosine 5'-phosphate from snake venom hydrolysates of transfer RNA.

A procedure for the quantitative measurement of the O2'-methylnucleoside constitutents of RNA has recently been developed in this laboratory (Gray, M.W. Can. J. Biochem. 53, 735-746 (1975)). This assay method is based on the resistance of O2'-methylnucleoside 5'-phosphates (pNm) (generated by phosphodiesterase hydrolysis of RNA) to subsequent dephosphorylation by venom 5'-nucleotidase (EC 3.1.3.5). In the present investigation, two base-modified 5'-nucleotides, each displaying an unusual resistance to 5'-nucleotidase, have been identified. These compounds have been characterized by a variety of techniques as N2, N2-dimethylguanosine 5'-phosphate (pm2/2G) and 3-(3-amino-3-carboxypropyl)uridine 5'-phosphate (p4abu3U). Because of their resistance to 5'-nucleotidase, pm2/2G and p4abu3U are isolated along with the pNm in the mononucleotide fraction of venom hydrolysates of transfer RNA. Under hydrolysis conditions, the stability of p4abu3U is comparable to that of a pNm, allowing quantitative assay of the nucleotide. The proportion (mean +/- SD) of p4abu3U in venom hydrolysates of wheat embryo and Escherichia coli tRNA has been determined to be 0.35 +/- 0.03 (n=5) and 0.14 +/- 0.02 (n=4) mol%, respectively. The absence of p4abu3U in venom hydrolysates of yeast tRNA implies the absence of the corresponding nucleoside in yeast tRNA, in agreement with existing data. The variable recovery of pm2/2G from venom hydrolysates of wheat embryo and yeast tRNA indicates that under hydrolysis conditions, this base-modified nucleotide is only partially resistent to 5'-nucleotidase. The complete absence of pm2/2G in venom hydrolysates of E. coli tRNA is consistent with the known absence of N2, N2-dimethylguanosine in this RNA. These observations demonstrate that resistance to 5'-nucleotidase is a necessary but not sufficient criterion for concluding that a 5'-nucleotide is O2'-methylated. When applied to wheat embryo ribosomal RNA, the analytical methods described in this report failed to reveal any compound having the distinctive charge properties of p4abu3U. It therefore appears that 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, recently characterized as a constituent of the 18 S rRNA of Chinese hamster cells (Saponara, A.G. & Enger, M.D. Biochim. Biophys. Acta 349, 61-77 (1974)), may not be present in wheat embryo ribosomal RNA.

Guanine Nucleotides↗
PubMed1975

Analysis of O2'-methylnucleoside 5'-phosphates in snake venom hydrolysates of RNA: identification of O2'-methyl-5-carboxymethyluridine as a constituent of yeast transfer RNA.

Snake venom phosphodiesterase liberates the O2-methylnucleoside (Nm) constituents of RNA as the corresponding 5-nucleotides (PNm), which, in contrast to normal 5-nucleotides (pN), are resistant to dephosphorylation by venom 5-nucleotidase. This property provides the basis of a convenient and highly reproducible quantitative assay for Nm residues in RNA. The assay method involves: (1) hydrolysis of RNA with whole or partially-purified snake venom; (2) isolation of the pNm derivatives, as a group, by anion-exchange chromatography on DEAE-cellulose; (3) resolution of the individual pNm compounds by two-dimensional paper chromatography; (4) identification and quantitative measurement of pNm derivatives by ultraviolet absorption spectrophotometry. Using this procedure, the molar proportions of the Nm constituents of wheat embryo, yeast, and Escherichia coli tRNA have been determined. The close correspondence between the values measured by venom hydrolysis and those obtained by analysis of alkali-stable dinucleotide (Nm-Np) sequences attests to the validity of the venom assay, and further indicates that alkali-stable sequences larger than dinucleotides are not present in significant amounts in the tRNA of the above three organisms. During the present investigation, several ultraviolet-absorbing components, not immediately identifiable as ribose-methylated nucleotides, were isolated along with the expected O2-methylnucleoside 5-phosphates. Preliminary characterization of one of these compounds suggests that it is a derivative of a novel nucleoside, O2-methyl-5-carboxymethyluridine (cm5Um is released as part of an alkali-stable dinucleotide, cm5Um-Ap. The proportion of pU-2 in venom hydrolysates of yeast tRNA (0.02 mol percent, the same as the content of cm5Um-Ap in alkaline hydrolysates) suggests that O2-methyl-5-carboxymethyluridine may be confined to a single isoaccepting species of tRNA in yeast. In an allied study, reinvestigation of the alkali-stable dinucleotide sequences of baker's yeast tRNA has confirmed previous results concerning the sequence distribution of O2-methylribose in yeast tRNA (Gray, M. W. & Lane, B.G. (1967) Biochim. Biophys. Acta 134, 243-257).

Escherichia coli↗