Search PubMed⌕ Search

Biomedical subjects

M Takano

Publications and source records attributed to M Takano.

At least 397 records · Page 22Linked to original sources
PubMed1986

Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T-cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription.

The cis-acting regulatory sequence of transcription from long terminal repeats (LTRs) of human T-cell leukemia virus type I and type II (HTLV-I and HTLV-II), which is essential for action of the virally encoded trans-acting transcriptional factor(s) designated pX(s), in HTLV-I and -II was identified. Deletion of most of the U3 region of the HTLV-I LTR resulted in loss of trans-acting transcriptional activation. However, when a tandem repeat of a 21-nucleotide sequence (GAAGGCTCTGACGTCTCCCCC) that is present in the U3 region of HTLV-I and -II LTRs was inserted into the deleted U3 region of the HTLV-I LTRs, chloramphenicol acetyltransferase activity was restored. The extent of restoration of activity was proportional to the number of copies of the sequence inserted. To test the possibility that the 21-nucleotide sequence alone is necessary for trans-activation, a sequence (AGGAACTGAAA) homologous to a type-specific viral enhancer sequence and present in the U3 region of HTLV-II LTR, but not in the same region of the HTLV-I LTR, was inserted together with the 21-nucleotide sequence into the deleted U3 region of the HTLV-I LTR. However, no significant differences of the levels of activities of those LTRs compared to the LTRs with only the 21-nucleotide sequence repeats were observed.

Acetyltransferases↗
PubMed1986

Direct demonstration of immunoregulatory T-cell defects in patients with systemic lupus erythematosus.

The present study was undertaken to determine directly whether immunoregulatory T cells have a defective suppressor function in patients with systemic lupus erythematosus (SLE), and whether anti-T-cell antibodies are essential for immunoregulatory T-cell defects. Peripheral blood T cells and T-cell subsets were determined in 52 SLE patients. The ratio of T4 to T8 cells was distributed over a wider range in patients with SLE than in the controls. Patients with SLE were divided into three groups (low, normal and high) by the T4/T8 ratio. Lymphocytes from 12 SLE patients (7 with low and 5 with high T4/T8 ratios) were studied extensively. Their disease was inactive or in remission. Anti-T-cell antibodies were not detected, and yet the patients had immunological abnormalities characterized by the presence of antinuclear antibodies and hypergammaglobulinaemia. The SLE patients with high T4/T8 ratios had a decreased number of T8 cells, and defective suppressor-effector cells. In contrast, patients with low T4/T8 ratios had decreased T4 cells and/or increased T8 cells, and defective suppressor-inducer cells. Two patients with low T4/T8 ratios had both suppressor-effector and suppressor-inducer cell defects. These results indicate that immunoregulatory circuits in SLE patients are heterogeneous and that immunoregulatory defects exist even when the disease is inactive or in remission. Anti-T-cell antibodies were not essential for such immunoregulatory defects. Thus, immunoregulatory T-cell defects and the development of SLE may be independent conditions due to other unknown causes.

Adult↗
PubMed1986

Structure of HTLV and its biological function in leukemogenesis of adult T-cell leukemia.

There is a high homology of nucleotide sequence between 3' two-thirds of the X (or pX) regions of human T-cell leukemia virus (HTLV)-I, and of HTLV-II. Monoclonal antibody against p41 coded from X-IV, an open reading frame of X region of HTLV-I, was established. Two proteins coded by Xb, one of the open reading frames in X region of HTLV-II, were newly identified as p24 and p26. The expression of X protein of HTLV-II in the reconstituted mouse embryonal carcinoma cell line, which shows myoblastic morphology, reverted the morphology to that of the original embryonal carcinoma cells. This suggests that the function of X protein is to disturb the regulation of cell lineage determination. Leukemogenesis of adult T-cell leukemia (ATL) is also considered to consist of multisteps, in which HTLV-I constitutes one step, other factors also being involved. Even the role of HTLV-I factor could be similarly played by other factor(s). In agreement with this hypothesis, there are patients with ATL without associated HTLV-I.

Adult↗
PubMed1986

Presence of albumin-positive cells in the liver of analbuminemic rats and their increase on treatment with hepatocarcinogens.

The analbuminemic rat is a mutant in which albumin mRNA processing is blocked owing to a seven-base-pair deletion in the 9th intron of the albumin gene. A small amount of albumin is detected in the serum of this rat. Production of serum albumin in the liver of this mutant rat was studied by an immunohistochemical method. The results showed that a few albumin-positive cells were present in the liver of the mutant rat, whereas all the hepatocytes in normal rat liver were albumin-positive. In the mutant the number of albumin-positive cells increased with age: their frequency was 10(-5) at birth and 6 X 10(-3) at 45 weeks of age. On administration of 3'-methyl-4-dimethylaminoazobenzene (3'-Me-DAB) and 2-acetylaminofluorene, albumin-positive cells increased dramatically. Their numbers were 7 to 10 times those of untreated rats after 10 to 16 weeks of carcinogen treatment. The number of albumin-positive cells did not decrease after 3'-Me-DAB feeding was discontinued. In regenerating liver after partial hepatectomy, clusters of albumin-positive cells increased while the number of singlet albumin-positive cells decreased. These observations suggest that the appearance of albumin-positive cells in analbuminemic rat liver may be due to a somatic mutation of the hepatocytes.

2-Acetylaminofluorene↗
PubMed1986

Effect of adriamycin entrapped by sulfatide-containing liposomes on ovarian tumor-bearing nude mice.

Sulfatide-containing liposomes showed the highest degree of adriamycin entrapment of all the liposomes tested. Adriamycin was bound to the sulfatide anions on the liposomal membrane, inserted into the membrane, and incorporated into the aqueous compartment of the vesicle. Liposome-entrapped adriamycin was maintained at a much higher blood level than free adriamycin, and reached a lower concentration in the heart than did the free drug, which might lead to lower cardiotoxicity of the drug. Incorporation of adriamycin into ovarian tumor transplanted into nude mice was increased when entrapped by the sulfatide-containing liposomes. Liposome-entrapped adriamycin did not induce the drastic loss of body weight which occurred with the free drug. The growth of ovarian tumor was inhibited by liposome-entrapped adriamycin to the same degree as free adriamycin. Having these advantages, sulfatide-containing liposomes could be useful carriers of adriamycin for cancer chemotherapy.

Animals↗
PubMed1985

Distinction of three types of D-glucose transport systems in animal cells.

Immunoblotting of plasma membrane fractions from rat kidney cortex with antibody to human erythrocyte glucose transporter showed a single major cross-reacting material of 48K in basolateral membrane fractions possessing a facilitated diffusion system for D-glucose, but not in brush border membrane fractions which have a Na-dependent active transport system. Cytochalasin B inhibited D-glucose uptake in basolateral membrane vesicles but not in brush border vesicles. Cross-reacting materials of 44-55K were detected in several animal cells exhibiting facilitated diffusion systems, including a hormone dependent system. These results indicate molecular difference between glucose transporters of facilitated diffusion systems and active transport systems.

Adipose Tissue↗
PubMed1985

Cimetidine transport in rat renal brush border and basolateral membrane vesicles.

The transport of cimetidine by rat renal brush border and basolateral membrane vesicles has been studied in relation to the transport system of organic cation. Cimetidine inhibited [3H]tetraethylammonium uptake by basolateral membrane vesicles in a dose dependent manner, and the degree of the inhibition was almost the same as that by unlabeled tetraethylammonium. In contrast, cimetidine inhibited the active transport of [3H]tetraethylammonium by brush border membrane vesicles more strongly than unlabeled tetraethylammonium did. In agreement with the transport mechanism of tetraethylammonium in brush border membranes, the presence of an H+ gradient ([H+]i greater than [H+]o) induced a marked stimulation of cimetidine uptake against its concentration gradient (overshoot phenomenon), and this concentrative uptake was inhibited by unlabeled tetraethylammonium. These results suggest that cimetidine can share common carrier transport systems with tetraethylammonium in renal brush border and basolateral membranes, and that cimetidine transport across brush border membranes is driven by an H+ gradient via an H+-organic cation antiport system.

Animals↗
PubMed1985

Methylation pattern of human T-cell leukemia virus in vivo and in vitro: pX and LTR regions are hypomethylated in vivo.

The methylation patterns of the gag, pol, env, pX and LTR regions of proviral DNA of human T-cell leukemia/lymphoma virus type I (HTLV) in fresh leukemic cells and established cell lines were examined using HpaII/MspI endonuclease. Peripheral blood lymphocytes (PBL) isolated from patients with adult T-cell leukemia/lymphoma (ATL) did not express viral antigens of HTLV, but PBL that had been cultured for 2 days did express these viral antigens. Most parts of the gag, pol and env regions of the HTLV provirus in PBL isolated from 12 ATL patients and PBL cultured for 2 days were hypermethylated as reported by others. In contrast, in 10 established cell lines that harbored HTLV genomes and expressed viral antigens, HTLV proviruses were hypomethylated. In one cell line, ATL-IK, which harbored an HTLV genome but did not produce viral antigens, the gag, pol and env regions were hypermethylated. However, two HpaII sites, one in the middle of the gag region and the other in the middle of the pol region, were not methylated even in PBL from most ATL patients. Furthermore, the pX and LTR regions were hypomethylated not only in established cell lines but also in PBL of ATL patients. The hypomethylation of the pX and LTR regions detected in fresh leukemic cells of ATL patients may have some etiological significance in cell transformation by controlling the level of transcription of these regions, or modulating the binding of some factors to these regions.

Adult↗
PubMed1985

New computed radiography using scanning laser stimulated luminescence.

This short paper summarizes the basic concept and the technology of a new computed radiographic system which uses an energy-storage phosphorus panel called "Imaging Plate" as an image sensor. The "Imaging Plate" can be used to obtain radiographs in exactly the same way as the screen-film combination is used in conventional radiography. The system eliminates the drawbacks of conventional screen-film radiography by combining digital image processing and digitization of the x-ray energy pattern utilizing scanning laser stimulated luminescence.

Analog-Digital Conversion↗
PubMed1985

Computed panoramic tomography with scanning laser-stimulated luminescence.

A new imaging system for the dental field that combines recent advances in both the electronics and computer technologies was developed. It is a panoramic tomography process based on the newly developed laser-scan system and an imaging system featuring (1) clear images with abundant diagnostic information and wide latitude; (2) the possibility of new diagnostic methods through image-information processing; and (3) reduction of exposure to a minimum.

Adult↗
PubMed1985

Identification of new gene products coded from X regions of human T-cell leukemia viruses.

Antibodies were raised against oligopeptides deduced from the nucleotide sequence in the conserved region located between env and the 3' long terminal repeat in human T-cell leukemia virus type I (HTLV-I) and type II (HTLV-II) to detect a protein coded from this region in virus-infected cells. Two of these antibodies precipitated a protein of 41 kilo-daltons in HTLV-I-infected cell lines and a protein of 38 kilo-daltons in HTLV-II-infected cells. The protein in HTLV-I-infected cells was precipitated by plasma from patients with adult T-cell leukemia but not by plasma from a normal adult. These results indicate that these proteins were translated from new coding regions (X) present in HTLV-I and HTLV-II.

Base Sequence↗
PubMed1985

Molecular orientation of plastocyanin on spinach thylakoid membranes as determined by acetylation of lysine residues.

To reveal the molecular orientation of plastocyanin (PC) on spinach thylakoid membranes, the position of Lys residues modified by acetic anhydride was compared between thylakoid-bound PC and the isolated one. Digestion of the isolated PC by a trypsin yielded a peptide map with seven spots prior to the acetylation of the protein; none of the spots appeared after the isolated PC was acetylated. On the other hand, there were two spots on the peptide map of the PC acetylated when it was bound to the thylakoids. Those spots were revealed by their amino acid compositions to correspond to the peptide fragments Phe 82-Lys 95 and Val 96-Asn 99. Thus, the Lys residues 81 and 95 of the thylakoid-bound PC were not acetylated. These results suggest that the PC molecule binds to the thylakoids with a specific region including the Lys's 81 and 95 in contact with the membranes. The Lys's 81 and 95 are located near Tyr 83, which has been thought to be the delivery site of electrons from the Cu2+ center.

Acetylation↗
PubMed1985

Destruction of the outer membrane permeability barrier of Escherichia coli by heat treatment.

Heat treatment of a wild-type Escherichia coli strain at 55 degrees C in 50 mM Tris-hydrochloride buffer with or without 10 mM magnesium sulfate or HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid) buffer at pH 8.0 caused an increase in cell surface hydrophobicity. By determining the location of n-hexadecane droplets attached to cells by phase-contrast microscopy, the septal and polar regions of heated cells appeared to become the most frequently hydrophobic. Some of the lipopolysaccharide molecules in the outer membrane were released from heated cells, and the cells became susceptible to the hydrolytic action of added phospholipase C. Heat-treated cells also became permeable to the hydrophobic dye crystal violet, which was added externally. The release of part of the outer membrane by heat treatment appeared to bring about the disorganization of the outer membrane structure and, as a consequence, to result in the partial disruption of the permeability barrier function of the outer membrane. Tris was found to enhance damage to the outer membrane by heat.

Alkaline Phosphatase↗
PubMed1985

Involvement of autolysin in cellular lysis of Bacillus subtilis induced by short- and medium-chain fatty acids.

The addition of saturated C6, C8, C10, and C12 fatty acids appeared to lyse actively growing cells of Bacillus subtilis 168, as judged by a decrease in the optical density of the culture. Of these fatty acids, dodecanoic acid was the most effective, with 50% lysis occurring in about 30 min at a concentration of 0.5 mM. These conditions also decreased the amount of peptidoglycan estimated by the incorporated radioactivity of N-acetyl-D-[1-14C]glucosamine. At concentrations above 1 mM, however, bacterial lysis was not extensive. Dodecanoic acid did not affect autolysis of the cell wall. The lytic action of dodecanoic acid was greatly diminished in cells in which protein synthesis was inhibited and in an autolytic enzyme-deficient mutant. The results suggest that fatty acid-induced lysis of B. subtilis 168 is due to the induction of autolysis by an autolytic enzyme rather than massive solubilization of the cell membrane by the detergent-like action of the fatty acids.

Amidohydrolases↗
PubMed1985

Pulmonary aspergillosis in apparently healthy young rabbits.

Pulmonary aspergillosis was discovered in apparently healthy young rabbits. Thirty-five rabbits of various ages raised in the same rabbitry were examined by histological, ultrastructural and microbiological methods. The pulmonary lesions were found only in rabbits younger than five weeks old. These lesions contained characteristically shaped hyphae surrounded by eosinophilic radiating projections--"asteroid bodies." The significance of the disease condition and the structure of the "asteroid bodies" is discussed.

Animals↗