Search PubMed⌕ Search

Biomedical subjects

M Takanami

Publications and source records attributed to M Takanami.

At least 91 records · Page 5Linked to original sources
PubMed1976

Sequence of promoter for coat protein gene of bacteriophage fd.

The nucleotide sequence in the promoter region for the coat protein gene of phage fd has been determined. This sequence contains an endonuclease R-Hha cleavage site at the fifteenth nucleotide upstream from the RNA start site. Cleavage results in loss of promoter function. Comparison with the sequence of another fd promoter indicates that the longest sequence common to both was TATAAT in the region in which RNA polymerase forms a stable initiation complex.

Base Sequence↗
PubMed1975

The nucleotide sequence of an RNA polymerase binding site on bacteriophage fd DNA.

The nucleotide sequence of the RNA polymerase binding site at a promotor on fd RF DNA has been determined in comparison with the starting sequence of RNA initiated at this promoter. The RNA polymerase binding site contained the startpoint of transcription in the centre and a region with twofold symmetry in the non-transcribed part.

Base Sequence↗
PubMed1975

Studies on bacteriophage fd DNA. III. Nucleotide sequence preceding the RNA start-site on a promoter-containing fragment.

A short DNA fragment containing a strong promoter was isolated from phage fd replicative form DNA with the use of restriction endonucleases, and the sequence of 110 nucleotides in the region preceding the RNA start-site was determined. The sequence was : (5') CGGTCTGGTTCGCTTTGAGGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATCGAATTCGCTTTGCTTCTGACTATAATAGACAGG (3').

Base Sequence↗