Search PubMed⌕ Search

Biomedical subjects

M Schubert

Publications and source records attributed to M Schubert.

At least 181 records · Page 10Linked to original sources
PubMed1982

In vitro transcription of vesicular stomatitis virus. Incorporation of deoxyguanosine and deoxycytidine, and formation of deoxyguanosine caps.

Detergent-disrupted vesicular stomatitis virus carried out in vitro transcription at a reduced rate in the presence of deoxyguanosine triphosphate. The transcripts annealed completely to excess vesicular stomatitis virus genomic RNA and consistent of the short leader RNA and even polyadenylated messenger RNA. Incubation with RNase T1 showed that the transcripts were resistant to cleavage. Nearest-neighbor analysis demonstrated that approximately two-thirds of the guanosine residues had been replaced by deoxyguanosine. The hybrid "deoxyguanosine-RNAs" carried cap structures which contained deoxyguanosine instead of guanosine. Competition experiments using both guanosine- and deoxyguanosine triphosphates indicated that GpppA and dGpppA cap structures were synthesized in approximately equal amounts at a ratio of 20 microM guanosine triphosphate to 50 microM deoxyguanosine triphosphate. Deoxyguanosine triphosphate was accepted by the polymerases of various strains and serotypes of vesicular stomatitis virus, demonstrating that its incorporation was a common characteristic. Deoxycytidine triphosphate could also substitute for cytidine triphosphate but to a lesser degree. Deoxyadenine, deoxyuridine-, and thymidine triphosphates were not or were very poorly accepted even at concentrations of 2 MM.

Deoxycytidine↗
PubMed1982

In vitro transcription of vesicular stomatitis virus: initiation with GTP at a specific site within the N cistron.

In vitro transcripts of vesicular stomatitis virus (VSV) were either 5'-terminally labeled by incorporation of [beta-(32)P]GTP or were selected on Hg-agarose after incorporation of gamma-thio-GTP. Capped RNAs ranged in size from 23 nucleotides, the shortest capped RNA detected, to full-length message size. The 5'-terminal sequences corresponded to those of N message and to a small amount of NS message. Approximately 14% of the capped N gene transcripts were terminated at positions 86 to 90 of the VSV genome, giving rise to specific, 36 to 40-nucleotide-long, capped RNA species. The GTP-initiated RNAs were short with a predominant 28-nucleotide-long RNA species. A minor portion was as large as mRNAs. Nucleotide sequence analyses of the short RNA revealed that it was specifically initiated at positon 91 of the VSV genome, 41 nucleotides within the N cistron. This corresponds exactly to the site where transcription of the 40-nucleotide-long, capped RNA terminated. Initiation with GTP at position 91 occurred at approximately the same frequency as termination of the capped RNA at position 90, suggesting that intracistronic initiation at position 91 may depend upon termination of transcription of the 5'-proximal region and therefore may be sequential. This unique RNA represents the first transcript of VSV which was initiated at an intracistronic site with GTP, and may also represent the first example of a transcript derived from a stop/start mechanism of VSV transcription in vitro. Although initiation occurred frequently at the beginning of the N cistron yielding 11 to 14-nucleotide-long, [beta-(32)P]ATP-labeled transcripts (D. F. Pinney and S. U. Emerson, J. Virol. 42:889-896, 1982), capping of these short RNAs was not detected. This suggests that transcripts may have to be 15 to 23 nucleotides long to be accepted as substrates by the guanyltransferase.

Base Sequence↗
PubMed1981

Structure and origin of a snapback defective interfering particle RNA of vesicular stomatitis virus.

The nucleotide sequence of the region which covalently links the complementary strands of the "snapback" RNA of vesicular stomatitis virus, DI011, is (Formula: see text). Both strands of the defective interfering (DI) particle RNA were complementary for their full length and were covalently linked by a single phosphate group. Because the strands were exactly the same length and complementary, template strand and daughter strand nucleocapsids generated during replication of DI 011 were undistinguishable on the basis of sequence, a property not shared by other types of DI particle RNAs. Treatment of the RNA with RNase T1 in high-ionic-strength solutions cleaved the RNA only between positions 1 and 1'. These results and the availability of the guanosine residue in position 1' to kethoxal, a reagent that specifically derivatizes guanosines of single-stranded RNA, suggest that steric constraints keep a small portion of the "turnaround" region in an open configuration. The sequence of the turnaround region was not related in any obvious way to the sequences at the 3' and 5' termini and limited the number of possible models for the origin of this type of DI particle RNA. Two models for the genesis of DI 011 RNA are discussed. We favor one in which the progenitor DI 011 RNA was generated by replication across a nascent replication fork.

Base Sequence↗
PubMed1981

Polyadenylation sites for influenza virus mRNA.

Polyadenylated transcripts of influenza virus RNA are incomplete copies of the individual genome segments, lacking sequences complementary to the 5'-terminal nucleotides of the virion RNA. By using a procedure which depends on the polyadenylic acid tail of the mRNA being encoded in part by the genome, we have determined that the common tract of uridine residues, approximately 17 to 22 nucleotides from the 5' end of each segment, is the site of polyadenylation of influenza virus mRNA.

Base Sequence↗
PubMed1981

In vivo transcription of the 5'-terminal extracistronic region of vesicular stomatitis virus RNA.

In vivo transcription and polyadenylation at the junction of the L cistron and the 5'-terminal extracistronic region of vesicular stomatitis virus RNA was investigated. Annealing of 5'32P-labeled RNA representing the 5'-terminal noncoding 77 nucleotides of vesicular stomatitis virus genomic RNA to L gene mRNA resulted in specific duplex formation. Two specific RNase T1- and RNase A resistant duplexes, 66 and 77 nucleotides long, bound to oligodeoxythymidylic acid cellulose. The specific sizes of the duplexes and their selection by oligodeoxythymidylic acid cellulose chromatography demonstrated that they were covalently linked to the polyadenylic acid tail of L gene mRNA. These data strongly suggest that the viral polymerase polyadenylates L gene mRNA in vivo by using the stretch of seven uridine residues at the end of the L cistron and that the polymerase can resume transcribing the 5'-terminal extracistronic region, resulting in a covalent linkage of the transcript to the polyadenylic acid tail of L gene mRNA.

Genes↗
PubMed1980

Polycistronic vesicular stomatitis virus RNA transcripts.

A procedure to enrich for the sequences present at the junction between the linked messages in the polycistronic RNAs symthesized in vitro by vesicular stomatitis virus (VSV) is described. Analyses of these sequences show that they contain a precise transcript of both the intercistronic dinucleotide and the pentanucleotide 5'--C-U-G-U-U--3', common to the 5'-end of all VSV cistrons, covalently linked to the 3'-side of the intervening poly(A). The data strongly suggest that the VSV transcriptase polyadenylylates the mRNAs and can then resume direct and precise transcription of the genome-without reinitiation and without skipping nucleotides.

Base Sequence↗
PubMed1980

Intervening sequence between the leader region and the nucleopcapsid gene of vesicular stomatitis virus RNA.

The base sequence at the 3' end of vesicular stomatitis virus RNA was determined by using terminal labels and chemical RNA sequencing. The leader RNA was complementary to 47 bases at the 3' terminus, whereas the nucleocapsid gene (N) began 51 nucleotides from the 3' end of the genomic RNA. The intervening bases were 3'...GAAA...5' for the Indiana serotype and 3'...GAAAA...5' for the New Jersey serotype. The complements of these bases did not appear in either the leader RNA or the N mRNA. This sequence may function as a stop signal or cleavage site during transcription. Furthermore, processing or termination at this sequence must be inhibited during the production of full-length RNA plus-sense strands (replication). We recently found similar sequences approximately 46 to 48 nucleotides from the 3' ends of several defective interfering particle RNAs where the short defective interfering particle transciption products terminate. This sequence is present also at the end of the polymerase (L) gene.

Base Sequence↗
PubMed1980

Site on the vesicular stomatitis virus genome specifying polyadenylation and the end of the L gene mRNA.

The 5'-terminal nucleotide sequence from positions 50 to 130 of vesicular stomatitis virus RNA was determined indirectly by using a defective interfering particle RNA which contains covalently linked genomic minus and antigenomic plus sense RNAs. The last 18 nucleotides of the L gene coding for in the viral polymerase were identified and isolated by specific duplex formation between 5' terminally labeled oligonucleotides from a small single-stranded defective interfering particle RNA and L gene mRNA. The L gene ends at position 60 from the 5' terminus of the vesicular stomatitis genome. The data demonstrated that the first seven adenine residues in the polyadenylic acid tail of L gene mRNA may be coded for in the genome and suggested that the viral transcriptase itself may carry out polyadenylation, possibly by chattering at the uridine-rich sequence at the end of the L gene. Analysis of the 5'-terminal sequence of vesicular stomatitis virus genomic RNA revealed that it might fold into a complex secondary structure with possibly 62% of the bases paired.

Base Sequence↗
PubMed1980

A solid phase immunofluorescent assay for the measurement of salivary immunoglobulin and albumin levels.

A solid phase immunofluorescence assay which can be used to measure immunoglobulin and albumin levels in whole saliva, as well as in duct collected saliva samples, is described. This method is about an order of magnitude more sensitive than the conventional radial immunodiffusion method, allowing its use in situations involving large numbers of samples or restricted sample volumes. The relative precision and accuracy of this method are comparable to those of radial immunodiffusion.

Adolescent↗
PubMed1979

Terminal sequences of vesicular stomatitis virus RNA are both complementary and conserved.

The nucleotide sequences at the 5' and 3' termini of RNA isolated from the New Jersey serotype of vesicular stomatitis virus [vsV(NJ)] and two of its defective interfering (DI) particles have been determined. The sequence differs from that previously demonstrated for the RNA from the Indiana serotype of VSV at only 1 of the first 17 positions from the 3' terminus and at only 2 of the first 17 positions from the 5' terminus. The 5'-terminal sequence of VSV(NJ) RNA is the complement of the 3'-terminal sequence, and duplexes which are 20 bases long and contain the 3' and 5' termini have been isolated from this RNA. The RNAs isolated from DI particles of VSV(NJ) have the same base sequences as do the RNAs from the parental virus. These results are in sharp contrast to those obtained with the Indiana serotype of VSV and its DI particles, in which the 3'-terminal sequences differ in 3 positions within the first 17. However, with both serotypes, the 3'-terminal sequence of the DI RNA is the complement of the 5'-terminal sequence of the RNA from the infectious virus. These findings suggest that the 3' and 5' RNA termini are highly conserved in both serotypes and that the 3' terminus of DI RNA is ultimately derived by copying the 5' end of the VSV genome, as recently proposed (D. Kolakofsky, M. Leppert, and L. Kort, in B. W. J. Mahy and R. D. Barry, ed., Negative-Strand Virus and the Host Cell, 1977; M. Leppert, L. Kort, and D. Kolakofsky, Cell 12:539-552, 1977; A. S. Huang, Bacteriol. Rev. 41:811-8218 1977).

Animals↗
PubMed1978

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.

Base Sequence↗
PubMed1978

Nucleotide sequence homology at the 3' termini of RNA from vesicular stomatitis virus and its defective interfering particles.

Vesicular stomatitis virus (VSV) and defective interfering (DI) particle RNAs were labeled at their 3' ends by using RNA ligase and cytidine 3',5'-bis[32P]phosphate. The RNAs were subjected to partial digestion with alkali and analyzed by oligonucleotide fingerprinting in two dimensions. VSV and DI particle RNAs have complete sequence homology for the first eight bases from the 3' end. The following four positions contain three mismatched nucleotides in which guanosine residues in one strand are replaced by uridine residues in the other. There is again complete homology for the next five bases (positions 13-17). The locations of purine residues within the sequence were confirmed by partial digestion with RNase T1 and RNase U2 and separation by size on 20% acrylamide gels. The latter method also indicated that sequences of VSV and DI particle RNAs diverge beyond the 18th nucleotide from the 3' termini.

Base Sequence↗
PubMed1975

[Chemotaxis of human polymorphonuclear cells in vitro. Study of inflammatory rheumatic diseases].

Sixty-eight determinations of leukocyte chemotaxis were performed in 42 patients suffering from systemic lupus erythematodes (17 cases), rheumatoid arthritis (15 cases) and scleroderma (10 cases). In contrast to the results of others, this study showed a deficiency in only 15 of 42 cases (35.7%). Impairment of chemotaxis was always transitory and demonstrable only during acute phases of disease. Intrinsic deficiency of PMN leukocytes as well as deficiency of plasma factors were related to the clinical and biological course of the disease and to the treatment.

Antibodies, Antinuclear↗