Biomedical subjects
M Parmentier
Publications and source records attributed to M Parmentier.
Molecular genetics of the thyrotropin receptor.
Explore the source record for details and available documents.
Identification of orphan G protein-coupled receptors.
Explore the source record for details and available documents.
Molecular cloning of a human cannabinoid receptor which is also expressed in testis.
A cDNA clone encoding a receptor protein which presents all the characteristics of a guanine-nucleotide-binding protein (G-protein)-coupled receptor was isolated from a human brain stem cDNA library. The probe used (HGMP08) was a 600 bp DNA fragment amplified by a low-stringency PCR, using human genomic DNA as template and degenerate oligonucleotide primers corresponding to conserved sequences amongst the known G-protein-coupled receptors. The deduced amino acid sequence encodes a protein of 472 residues which shares 97.3% identity with the rat cannabinoid receptor cloned recently [Matsuda, Lolait, Brownstein, Young & Bronner (1990) Nature (London) 346, 561-564]. Abundant transcripts were detected in the brain, as expected, but lower amounts were also found in the testis. The same probe was used to screen a human testis cDNA library. The cDNA clones obtained were partially sequenced, demonstrating the identity of the cannabinoid receptors expressed in both tissues. Specific binding of the synthetic cannabinoid ligand [3H]CP55940 was observed on membranes from Cos-7 cells transfected with the recombinant receptor clone. In stably transfected CHO-K1 cell lines, cannabinoid agonists mediated a dose-dependent and stereoselective inhibition of forskolin-induced cyclic AMP accumulation. The ability to express the human cannabinoid receptor in mammalian cells should help in developing more selective drugs, and should facilitate the search for the endogenous cannabinoid ligand(s).
Structure of the human brain calcium-binding protein calretinin and its expression in bacteria.
Calbindin D28k and calretinin are two closely related intracellular calcium-binding proteins belonging to the troponin C superfamily. Calbindin is known to be involved in the vitamin-D-dependent calcium absorption through intestinal and renal epithelia, while the function of neuronal calbindin and calretinin is poorly understood. Using antibodies directed against chick intestinal calbindin D28k, human calretinin cDNA clones were isolated from brain cDNA libraries. The sequence of the calretinin cDNA revealed an open reading frame of 271 codons coding for a protein of 31,520 Da, and sharing 58% identical residues with human calbindin D28k. Calretinin contains five presumably active and one presumably inactive calcium-binding domains. Comparison with the partial sequences available for chick and guinea pig calretinins revealed that the protein is highly conserved in evolution (evolutionary rate: 0.27 x 10(-9) amino acid-1 year-1). The calretinin message was detected in the brain, while absent from heart muscle, kidney, liver, lung, spleen, stomach and thyroid gland. Recombinant calretinin was expressed in Escherichia coli, and the calcium-binding properties were confirmed on both the natural and the recombinant proteins. Part of the human gene coding for calretinin was isolated and the region corresponding to the promoter and the first exon was sequenced.
The orphan receptor cDNA RDC7 encodes an A1 adenosine receptor.
The extensive amino acid sequence conservation among G protein-coupled receptors has been exploited to clone new members of this large family by homology screening or by PCR. Out of four such receptor cDNAs we cloned recently, RDC7 corresponds to a relatively abundant transcript in the brain cortex, the thyroid follicular cell and the testis. We have now identified RDC7 as an A1 adenosine receptor. The A1 agonist CPA [N6-cyclopentyladenosine] decreased by 80% cAMP accumulation in forskolin-stimulated CHO cells stably transfected with RDC7. Specific binding of another A1 adenosine agonist, [3H]CHA [N6-cyclohexyladenosine], was demonstrated on membranes from Cos cells transfected with a pSVL construct harbouring the RDC7 cDNA insert. The binding characteristics were similar to those of the natural brain A1 receptor. The recombinant and the natural receptors behaved also in the same way in displacement experiments involving a series of A1 adenosine agonists. The binding characteristics of RDC7 were compared to those of RDC8, another orphan receptor recently identified as an A2 adenosine receptor. The two molecular species RDC7 and RDC8 correspond clearly to the A1 and A2 receptor entities defined hitherto on a purely pharmacological basis.
Follitropin receptor down-regulation involves a cAMP-dependent post-transcriptional decrease of receptor mRNA expression.
The regulation by FSH (follitropin; follicle-stimulating hormone) of FSH receptor mRNA and protein (FSH binding) was studied using cultured Sertoli cells isolated from 21-day-old rats. FSH induced a dose-dependent and almost complete down-regulation of receptor mRNA at 4 h after addition of the hormone. At subsequent time points (16 h and later) the FSH receptor mRNA levels had returned close to control values. The effect of FSH was mimicked by dibutyryl cyclic AMP (dbcAMP) and forskolin, and the phosphodiesterase inhibitor methyl-isobutylxanthine (MIX) prolonged the FSH action. These findings indicate that the effect of FSH on its receptor mRNA was mediated by cAMP. A down-regulatory effect of FSH and dbcAMP on FSH receptor mRNA was also observed in the presence of the protein synthesis inhibitor cycloheximide, suggesting a direct effect of FSH/dbcAMP on the expression of the FSH receptor gene. Transcriptional run-on experiments revealed that FSH did not inhibit initiation of the FSH receptor gene; hence a post-transcriptional mechanism is involved. Binding of 125I-FSH to the cultured Sertoli cells was rapidly (4 h) decreased when the cells were incubated with FSH or FSH in combination with MIX. This effect can be explained by ligand-induced receptor sequestration. In contrast, incubation of Sertoli cells with dbcAMP had no effect on binding of 125I-FSH after 4 h, but resulted in a 60% loss of FSH binding sites after 24 h, probably caused by decreased mRNA expression. In conclusion, FSH receptor down-regulation in Sertoli cells is effected not only by the well-documented ligand-induced loss of receptors from the plasma membrane, but also involves a cAMP-mediated decrease of FSH receptor mRNA through a post-transcriptional mechanism.
A new human hypervariable locus (K29) maps to the q37.3 region of chromosome 2 and reveals a fingerprint.
A human genomic library was screened with a 30-base oligomer corresponding to the 5' end of the human calretinin cDNA. A clone that contains a minisatellite composed of 21 imperfect repeats of a 37-bp sequence was isolated. The consensus (GAGGGAGGAACTGGGACGCGTGCATGTTTGCATTCTC) incidentally shares 14 consecutive matches with the oligomer used as a probe, and it was shown that the clone did not belong to the calretinin locus. The minisatellite, named K29, was used as a probe on Southern blots at high stringency. After HaeIII, MboI, or HinfI digestion, it detected a single hypervariable locus, with 65% heterozygosity among Caucasian individuals. The probe used at low stringency revealed a fingerprint, with an average of four bands in addition to the locus-specific pattern. Mendelian inheritance was assessed on pedigrees. The K29 minisatellite was mapped by in situ hybridization to the very end of the long arm of chromosome 2 (2q37.3 band), at close proximity of the Fra2J locus, and is referred to as the D2S88 locus in the genome database.
Chromosomal mapping of A1 and A2 adenosine receptors, VIP receptor, and a new subtype of serotonin receptor.
cDNA clones encoding four new receptors of the G-protein-coupled receptor family were obtained by selective amplification and cloning from thyroid cDNA and termed RDC1, RDC4, RDC7, and RDC8. RDC7 and RDC8 have recently been identified as A1 and A2 adenosine receptors, respectively. These cDNAs were utilized for chromosomal in situ hybridization to establish the genomic location of the corresponding genes in man. The results indicate that human RDC1, RDC4, RDC7, and RDC8 are in regions 2q37, 1p34.3-1p36.3, 22q11.2-22q13.1, and 11q11-11q13, respectively.
Current developments in G-protein-coupled receptors.
The rate at which receptors have been cloned has recently increased dramatically--existing families have been extended and new families created. The rapid cloning by homology of 'orphan receptors' has also stimulated the development of a new reverse pharmacology.
The human calbindin D28k (CALB1) and calretinin (CALB2) genes are located at 8q21.3----q22.1 and 16q22----q23, respectively, suggesting a common duplication with the carbonic anhydrase isozyme loci.
The genes encoding calbindin D28k (CALB1) and calretinin (CALB2), two closely related calcium-binding proteins, were mapped by in situ hybridization to the 8q21.3----q22.1 and 16q22----q23 regions of the human genome, respectively. These localizations match the chromosomal regions where the carbonic anhydrase isozyme gene cluster (CA1, CA2, CA3) and the related gene CA7 have been described, respectively. This suggests a common duplication o the calbindin/calretinin and the carbonic anhydrase ancestral genes.
Thyroid adenocarcinomas secondary to tissue-specific expression of simian virus-40 large T-antigen in transgenic mice.
A hybrid gene comprising the bovine thyroglobulin gene promoter and the coding region for the simian virus-40 large T- and small t-antigens was used to generate 30 transgenic mice by microinjection into the pronuclei of single cell embryos. All animals except three developed, as single primitive pathology, a dramatic enlargement of the thyroid gland. Compression of trachea and esophagus, accompanied by dyspnea, inspiratory stridor, and dysphagia, led to a progressive cachexia and premature death attributed to respiratory failure. Despite the large thyroid volume, T4 levels were abnormally low, and the progression of the syndrome could be delayed by a substitutive treatment with thyroid hormones. The rapid evolution of the disease, leading to the death of most founder transgenic animals before the breeding age, prevented transmission of the transgene to their offspring. Only two transgenic lines are presently surviving. Immunohistochemical analysis of the tissues revealed a specific expression of the simian virus-40 antigens in the thyroid cells. Hyperplasia was already obvious at birth. Older animals displayed moderately to poorly differentiated thyroid adenocarcinomas. Electron microscopy revealed, however, the persistence of cell polarity and the presence of microfollicles between the densely packed cells. Cell lines derived from these large T-expressing thyroids were shown to have lost expression of both thyroglobulin and thyroperoxidase, while expressing low levels of TSH receptors. These transgenic mice could constitute an interesting model of aggressive adenocarcinoma, sharing phenotypical similarities with the anaplastic type of human thyroid tumors.
The TSH cyclic AMP cascade in the control of thyroid cell proliferation: the story of a concept.
Thyrotropin stimulates the growth and proliferation of thyroid cells in vivo. Starting in the 1970, we have progressively shown that these effects could be reproduced in vitro in dog thyroid cells in primary culture. They are accompanied by the expression of differentiation. All the effects of thyrotropin are mediated by the cyclic AMP cascade. The best argument that this concept applies in vivo is the generation of hyperfunctioning adenoma involving the whole gland in transgenic mice expressing the constitutively active adenosine A2 receptor in the thyroid.
RDC8 codes for an adenosine A2 receptor with physiological constitutive activity.
The cDNA of an unidentified recently cloned G protein-coupled receptor, RDC8, has been expressed in Y1 adrenal cells, in dog thyrocytes in primary culture and in Xenopus oocytes. In all these systems this resulted in the activation of adenylyl cyclase and of the cyclic AMP cascade in the absence of any added external signal. However, this physiologically constitutive activator was inhibited by adenosine deaminase and by inhibitors of the adenosine A2 receptor. Cos 7 cells transfected with RDC8 cDNA constructs acquired binding characteristics of an adenosine A2 receptor. Moreover, RDC8 mRNA and adenosine A2 receptors display a very similar distribution in the brain. RDC8 therefore codes for an A2 adenosine receptor. Whether the physiologically constitutive activation of this receptor is entirely explained by endogeneously produced adenosine is as yet unknown.
Nucleotide sequence of a human cannabinoid receptor cDNA.
Explore the source record for details and available documents.
Use of the recombinant human thyrotropin receptor (TSH-R) expressed in mammalian cell lines to assay TSH-R autoantibodies.
We report on two assays for autoantibodies to the TSH-R which have been developed using materials from mammalian cells transfected with the cDNA for the human TSH-R. In the first, a particulate fraction has been prepared from COS cells, transiently expressing the human TSH-R and used in a radioreceptor assay in conjunction with bovine 125I-TSH. Immunoglobulins (IgGs) from patients with Graves' disease (n = 11) and idiopathic myxoedema (n = 2) have been used as competitors of 125I-TSH binding to the COS TSH-R membranes and the results have been compared with those obtained with a commercially available kit for measuring TSH-R autoantibodies, which uses solubilised porcine TSH-R. Both assays showed similar performance, being particularly sensitive to antibodies from patients with idiopathic myxoedema. In the second assay system we have used a CHO cloned cell line (JP26) stably transfected with the human TSH-R. A selection of IgG preparations from patients with Graves' disease and of six normal controls was used to test the ability of this cell line to detect thyroid stimulating immunoglobulins (TSAb) by increasing its cAMP production. The assay was performed under two conditions: in standard (isotonic) medium or in hypotonic medium. Freshly thawed human thyrocytes incubated in hypotonic medium served as a reference method. Only five patients scored positive when tested in the JP26 cell line under isotonic conditions. When the assay was performed in a hypotonic medium, a significant positive correlation was observed between the results given by JP26 cells and human thyrocytes.(ABSTRACT TRUNCATED AT 250 WORDS)
Stable expression of the human TSH receptor in CHO cells and characterization of differentially expressing clones.
The human thyrotropin receptor cDNA was transfected in CHO cells and individual clones were isolated. They were tested for their response to thyrotropin, forskolin and antibodies from a patient with high levels of thyroid stimulating antibodies. Several clones were characterized extensively with respect to membrane binding of labeled thyrotropin, cAMP accumulation in response to thyrotropin and kinetics of cAMP production. Data for three representative clones are presented. Receptor number as assessed by membrane binding of labeled thyrotropin, and cAMP production, measured in a thyrotropin response bioassay, are correlated. The Kd value for the human thyrotropin receptor expressed in CHO was estimated to be 50 pM.
Complete nucleotide sequence of a putative G protein coupled receptor: RDC8.
Explore the source record for details and available documents.