Search PubMedSearch

Biomedical subjects

M Parmentier

Publications and source records attributed to M Parmentier.

At least 19 recordsLinked to original sources

Cloning and functional expression of the canine anaphylatoxin C5a receptor. Evidence for high interspecies variability.

A cDNA clone, DTJP03, encoding an orphan receptor, was isolated from a canine thyroid library, and found to exhibit 68.6% amino-acid identity with the recently described human C5a receptor. This relatively low similarity first suggested that DTJP03 encoded either a C5a receptor subtype, or the presumably related C3a receptor. Binding studies performed on membranes from COS-7 cells expressing the recombinant receptor demonstrated that DTJP03 encoded a high-affinity C5a receptor, with a Kd of 1.2 nM. C3a was unable to compete for C5a binding. Intracellular free calcium concentrations were measured by Quin-2 fluorescence assays in Chinese hamster ovary cells stably transfected with the canine C5a receptor. C5a addition elicited an increase in the intracellular calcium concentration. Extracellular EGTA partially prevented this response, suggesting that activation of the C5a receptor promotes both the release of calcium from intracellular stores, and the influx of extracellular calcium. Genes encoding C5a-receptor subtypes were subsequently searched for by PCR in genomic DNA from human, canine, rat and bovine sources. The result was the amplification of a single gene fragment from each species, with about 70% identity between any two of them. The canine C5a receptor has therefore to be considered as orthologous to the human C5a receptor described previously. The low similarity between C5a receptors from different mammalian species is quite unusual for a G-protein-coupled receptor.

Amino Acid Sequence

Calretinin in rat ovary: an in situ hybridization and immunohistochemical study.

Calretinin is a cytosolic calcium-binding protein of the calmodulin superfamily, with high homology with calbindin D28k. The only cells in which calretinin has been described so far are neurons, in the central nervous system and in retina. In the present work, we describe the expression of the calretinin gene in the interstitial cells of rat ovary. Immunohistochemistry, using a calretinin-specific antibody, allowed to detect the protein from 19 days after birth. Western blot from ovary homogenates confirmed the labelling of a 29 kDa band, the size of calretinin. In situ hybridization confirmed immunochemical data; calretinin transcripts were clearly shown in the same cell population. This represents the first description of calretinin outside the nervous system. Its function in ovary remains to be determined.

Animals

Molecular cloning, functional expression and pharmacological characterization of a human bradykinin B2 receptor gene.

The gene encoding a putative G protein-coupled receptor (HG10) was cloned from human genomic DNA by low stringency PCR and found to be homologous to the recently described rat bradykinin B2 receptor. The receptor was expressed in xenopus oocytes and stably transfected CHO cell lines. Binding studies demonstrated that HG10 encodes a high affinity BK receptor with an apparent Kd of 150 pM. Displacement by BK agonists and antagonists allowed the characterization of the receptor as a B2 subtype. Functional coupling to the Ca(2+)-phosphatidylinositol cascade was demonstrated in transfected CHO cells where inositol phosphates accumulation and intracellular calcium concentration were elevated in response to BK stimulation. The agonistic and antagonistic properties of BK analogs do not match strictly the pharmacological profile described for the rat or guinea pig B2 receptor subtypes or the putative B3 subtype. This discrepancy is attributed either to species variability or to differences in the coupling efficiency of receptors to the transduction cascade in different cell types. From our results, the existence of B3 receptors and of B2 subtypes appears questionable.

Amino Acid Sequence

Distribution of cannabinoid receptor messenger RNA in the human brain: an in situ hybridization histochemistry with oligonucleotides.

The distribution of the messenger RNA coding for the recently cloned cannabinoid receptor was studied for the first time in the human brain using in situ hybridization histochemistry and oligonucleotides probes. Microscopically, positive neurons were observed in the layers II-III and V-VI of the cerebral cortex, and in the hilus and the different dendritic layers of the dentate gyrus and Ammon's horn of the hippocampus. No additional microscopic signal could be detected. Macroscopically, a slight hybridization signal, visible on the films after 2 months exposure and which disappears after RNAse treatment, was also found throughout all layers of the cortex, in the pyramidal cell layer of the hippocampus, in the caudate and putamen, and in the granular and molecular layers of the cerebellum. No signal was detected in the brainstem, spinal cord and white matter. In conclusion, the cannabinoid receptor mRNA neuronal localizations here demonstrated in the human brain confirm our previous report in the rat, taking into account that the levels of the transcripts found in the human were lower than in the rat brain.

Adult

Expression of members of the putative olfactory receptor gene family in mammalian germ cells.

A series of genomic and complementary DNA clones encoding new putative members of G protein-coupled receptors were isolated using homology cloning and low-stringency polymerase chain reaction. Among the unidentified receptors ('orphan receptors'), a human genomic clone (HGMP07) was characterized by the presence of its transcripts in the testis and by its belonging to a large subfamily of genes sharing extensive sequence similarities. Sequence comparison demonstrated that this gene subfamily is the human counterpart of the putative rat olfactory receptors cloned recently. Another 48 members of the family were cloned. Northern blotting further demonstrated the presence of olfactory receptor transcripts in germ cells. Our finding suggests that a common receptor gene family encodes olfactory receptors and sperm cell receptors that could be involved in chemotaxis during fertilization.

Amino Acid Sequence

Thyroid expression of an A2 adenosine receptor transgene induces thyroid hyperplasia and hyperthyroidism.

Cyclic AMP (cAMP) is the major intracellular second messenger of thyrotropin (TSH) action on thyroid cells. It stimulates growth as well as the function and differentiation of cultured thyrocytes. The adenosine A2 receptor, which activates adenylyl cyclase via coupling to the stimulating G protein (Gs), has been shown to promote constitutive activation of the cAMP cascade when transfected into various cell types. In order to test whether the A2 receptor was able to function similarly in vivo and to investigate the possible consequences of permanent adenylyl cyclase activation in thyroid cells, lines of transgenic mice were generated expressing the canine A2 adenosine receptor under control of the bovine thyroglobulin gene promoter. Thyroid-specific expression of the A2 adenosine receptor transgene promoted gland hyperplasia and severe hyperthyroidism causing premature death of the animals. The resulting goitre represents a model of hyperfunctioning adenomas: it demonstrates that constitutive activation of the cAMP cascade in such differentiated epithelial cells is sufficient to stimulate autonomous and uncontrolled function and growth.

Adenosine

Molecular cloning of a human cannabinoid receptor which is also expressed in testis.

A cDNA clone encoding a receptor protein which presents all the characteristics of a guanine-nucleotide-binding protein (G-protein)-coupled receptor was isolated from a human brain stem cDNA library. The probe used (HGMP08) was a 600 bp DNA fragment amplified by a low-stringency PCR, using human genomic DNA as template and degenerate oligonucleotide primers corresponding to conserved sequences amongst the known G-protein-coupled receptors. The deduced amino acid sequence encodes a protein of 472 residues which shares 97.3% identity with the rat cannabinoid receptor cloned recently [Matsuda, Lolait, Brownstein, Young & Bronner (1990) Nature (London) 346, 561-564]. Abundant transcripts were detected in the brain, as expected, but lower amounts were also found in the testis. The same probe was used to screen a human testis cDNA library. The cDNA clones obtained were partially sequenced, demonstrating the identity of the cannabinoid receptors expressed in both tissues. Specific binding of the synthetic cannabinoid ligand [3H]CP55940 was observed on membranes from Cos-7 cells transfected with the recombinant receptor clone. In stably transfected CHO-K1 cell lines, cannabinoid agonists mediated a dose-dependent and stereoselective inhibition of forskolin-induced cyclic AMP accumulation. The ability to express the human cannabinoid receptor in mammalian cells should help in developing more selective drugs, and should facilitate the search for the endogenous cannabinoid ligand(s).

Amino Acid Sequence

Structure of the human brain calcium-binding protein calretinin and its expression in bacteria.

Calbindin D28k and calretinin are two closely related intracellular calcium-binding proteins belonging to the troponin C superfamily. Calbindin is known to be involved in the vitamin-D-dependent calcium absorption through intestinal and renal epithelia, while the function of neuronal calbindin and calretinin is poorly understood. Using antibodies directed against chick intestinal calbindin D28k, human calretinin cDNA clones were isolated from brain cDNA libraries. The sequence of the calretinin cDNA revealed an open reading frame of 271 codons coding for a protein of 31,520 Da, and sharing 58% identical residues with human calbindin D28k. Calretinin contains five presumably active and one presumably inactive calcium-binding domains. Comparison with the partial sequences available for chick and guinea pig calretinins revealed that the protein is highly conserved in evolution (evolutionary rate: 0.27 x 10(-9) amino acid-1 year-1). The calretinin message was detected in the brain, while absent from heart muscle, kidney, liver, lung, spleen, stomach and thyroid gland. Recombinant calretinin was expressed in Escherichia coli, and the calcium-binding properties were confirmed on both the natural and the recombinant proteins. Part of the human gene coding for calretinin was isolated and the region corresponding to the promoter and the first exon was sequenced.

Amino Acid Sequence

The orphan receptor cDNA RDC7 encodes an A1 adenosine receptor.

The extensive amino acid sequence conservation among G protein-coupled receptors has been exploited to clone new members of this large family by homology screening or by PCR. Out of four such receptor cDNAs we cloned recently, RDC7 corresponds to a relatively abundant transcript in the brain cortex, the thyroid follicular cell and the testis. We have now identified RDC7 as an A1 adenosine receptor. The A1 agonist CPA [N6-cyclopentyladenosine] decreased by 80% cAMP accumulation in forskolin-stimulated CHO cells stably transfected with RDC7. Specific binding of another A1 adenosine agonist, [3H]CHA [N6-cyclohexyladenosine], was demonstrated on membranes from Cos cells transfected with a pSVL construct harbouring the RDC7 cDNA insert. The binding characteristics were similar to those of the natural brain A1 receptor. The recombinant and the natural receptors behaved also in the same way in displacement experiments involving a series of A1 adenosine agonists. The binding characteristics of RDC7 were compared to those of RDC8, another orphan receptor recently identified as an A2 adenosine receptor. The two molecular species RDC7 and RDC8 correspond clearly to the A1 and A2 receptor entities defined hitherto on a purely pharmacological basis.

Adenosine

Follitropin receptor down-regulation involves a cAMP-dependent post-transcriptional decrease of receptor mRNA expression.

The regulation by FSH (follitropin; follicle-stimulating hormone) of FSH receptor mRNA and protein (FSH binding) was studied using cultured Sertoli cells isolated from 21-day-old rats. FSH induced a dose-dependent and almost complete down-regulation of receptor mRNA at 4 h after addition of the hormone. At subsequent time points (16 h and later) the FSH receptor mRNA levels had returned close to control values. The effect of FSH was mimicked by dibutyryl cyclic AMP (dbcAMP) and forskolin, and the phosphodiesterase inhibitor methyl-isobutylxanthine (MIX) prolonged the FSH action. These findings indicate that the effect of FSH on its receptor mRNA was mediated by cAMP. A down-regulatory effect of FSH and dbcAMP on FSH receptor mRNA was also observed in the presence of the protein synthesis inhibitor cycloheximide, suggesting a direct effect of FSH/dbcAMP on the expression of the FSH receptor gene. Transcriptional run-on experiments revealed that FSH did not inhibit initiation of the FSH receptor gene; hence a post-transcriptional mechanism is involved. Binding of 125I-FSH to the cultured Sertoli cells was rapidly (4 h) decreased when the cells were incubated with FSH or FSH in combination with MIX. This effect can be explained by ligand-induced receptor sequestration. In contrast, incubation of Sertoli cells with dbcAMP had no effect on binding of 125I-FSH after 4 h, but resulted in a 60% loss of FSH binding sites after 24 h, probably caused by decreased mRNA expression. In conclusion, FSH receptor down-regulation in Sertoli cells is effected not only by the well-documented ligand-induced loss of receptors from the plasma membrane, but also involves a cAMP-mediated decrease of FSH receptor mRNA through a post-transcriptional mechanism.

1-Methyl-3-isobutylxanthine

A new human hypervariable locus (K29) maps to the q37.3 region of chromosome 2 and reveals a fingerprint.

A human genomic library was screened with a 30-base oligomer corresponding to the 5' end of the human calretinin cDNA. A clone that contains a minisatellite composed of 21 imperfect repeats of a 37-bp sequence was isolated. The consensus (GAGGGAGGAACTGGGACGCGTGCATGTTTGCATTCTC) incidentally shares 14 consecutive matches with the oligomer used as a probe, and it was shown that the clone did not belong to the calretinin locus. The minisatellite, named K29, was used as a probe on Southern blots at high stringency. After HaeIII, MboI, or HinfI digestion, it detected a single hypervariable locus, with 65% heterozygosity among Caucasian individuals. The probe used at low stringency revealed a fingerprint, with an average of four bands in addition to the locus-specific pattern. Mendelian inheritance was assessed on pedigrees. The K29 minisatellite was mapped by in situ hybridization to the very end of the long arm of chromosome 2 (2q37.3 band), at close proximity of the Fra2J locus, and is referred to as the D2S88 locus in the genome database.

Base Sequence

Chromosomal mapping of A1 and A2 adenosine receptors, VIP receptor, and a new subtype of serotonin receptor.

cDNA clones encoding four new receptors of the G-protein-coupled receptor family were obtained by selective amplification and cloning from thyroid cDNA and termed RDC1, RDC4, RDC7, and RDC8. RDC7 and RDC8 have recently been identified as A1 and A2 adenosine receptors, respectively. These cDNAs were utilized for chromosomal in situ hybridization to establish the genomic location of the corresponding genes in man. The results indicate that human RDC1, RDC4, RDC7, and RDC8 are in regions 2q37, 1p34.3-1p36.3, 22q11.2-22q13.1, and 11q11-11q13, respectively.

Chromosome Banding

Current developments in G-protein-coupled receptors.

The rate at which receptors have been cloned has recently increased dramatically--existing families have been extended and new families created. The rapid cloning by homology of 'orphan receptors' has also stimulated the development of a new reverse pharmacology.

Animals

The human calbindin D28k (CALB1) and calretinin (CALB2) genes are located at 8q21.3----q22.1 and 16q22----q23, respectively, suggesting a common duplication with the carbonic anhydrase isozyme loci.

The genes encoding calbindin D28k (CALB1) and calretinin (CALB2), two closely related calcium-binding proteins, were mapped by in situ hybridization to the 8q21.3----q22.1 and 16q22----q23 regions of the human genome, respectively. These localizations match the chromosomal regions where the carbonic anhydrase isozyme gene cluster (CA1, CA2, CA3) and the related gene CA7 have been described, respectively. This suggests a common duplication o the calbindin/calretinin and the carbonic anhydrase ancestral genes.

Calbindin 1

Thyroid adenocarcinomas secondary to tissue-specific expression of simian virus-40 large T-antigen in transgenic mice.

A hybrid gene comprising the bovine thyroglobulin gene promoter and the coding region for the simian virus-40 large T- and small t-antigens was used to generate 30 transgenic mice by microinjection into the pronuclei of single cell embryos. All animals except three developed, as single primitive pathology, a dramatic enlargement of the thyroid gland. Compression of trachea and esophagus, accompanied by dyspnea, inspiratory stridor, and dysphagia, led to a progressive cachexia and premature death attributed to respiratory failure. Despite the large thyroid volume, T4 levels were abnormally low, and the progression of the syndrome could be delayed by a substitutive treatment with thyroid hormones. The rapid evolution of the disease, leading to the death of most founder transgenic animals before the breeding age, prevented transmission of the transgene to their offspring. Only two transgenic lines are presently surviving. Immunohistochemical analysis of the tissues revealed a specific expression of the simian virus-40 antigens in the thyroid cells. Hyperplasia was already obvious at birth. Older animals displayed moderately to poorly differentiated thyroid adenocarcinomas. Electron microscopy revealed, however, the persistence of cell polarity and the presence of microfollicles between the densely packed cells. Cell lines derived from these large T-expressing thyroids were shown to have lost expression of both thyroglobulin and thyroperoxidase, while expressing low levels of TSH receptors. These transgenic mice could constitute an interesting model of aggressive adenocarcinoma, sharing phenotypical similarities with the anaplastic type of human thyroid tumors.

Adenocarcinoma