OBJECTIVE: To determine whether heat shock proteins (HSP) are expressed on the surface of peripheral blood (PB) lymphocytes and synovial fluid (SF) lymphocytes from patients with rheumatoid arthritis (RA). METHODS: Immunoprecipitation and flow cytometric analyses using anti-Yersinia enterocolitica HSP60 monoclonal antibodies (Mab) were performed. Phenotypes of surface HSP-positive lymphocytes were analyzed further by 2 color flow cytometry. RESULTS: Anti-Y. enterocolitica HSP60 Mab immunoprecipitated 120, 97, 70, 60, 55, and 50 kDa proteins in extracts of healthy donor PB lymphocytes and of Daudi cells after thermal shock. Among these proteins, the 60 kDa HSP showed the greatest degree of precipitation. Surface HSP-positive lymphocytes were detected in 2 of 16 PB and 1 of 12 SF lymphocyte samples. Longitudinal studies indicated that HSP were expressed on the surface of lymphocytes in the active stage, but not in the improvement stage of the disease. Surface HSP-positive lymphocytes were mainly either [gamma delta +] T cells or [CD19+] B cells. CONCLUSION: HSP were expressed on the surface of PB and SF lymphocytes from patients with RA. Surface HSP-positive lymphocytes might be recognized by lymphocytes since HSP are strongly immunogenic.

Adult↗

PubMed1996

[CpG motif in DNA from immune complexes of SLE patients augments expression of intercellular adhesion molecule-1 on endothelial cells].

The sequence of 9 DNA clones obtained from DNA-anti-DNA antibody immune complexes (IC) in 11 SLE patients was analyzed and the possible pathogenic role of the circulating DNA in SLE patients was discussed. Nucleic acid length of 9 cloned DNAs ranged from 87 to 312 base pairs(bp), with a mean length of 177 +/- 62bp, which were rich in guanine (G) + cytosine(C), CpG dinucleotide and palindromic sequences. Oligonucleotide TTTTCAATTCGAAGATGATT which contain the CpG motif in hexamer palindromic sequence segments in cloned DNA augmented the expression of ICAM-1 on the endothelial cells detected by FACS analysis and also augmented the gene expression of several cytokines such as interleukin-2, interleukin-6, interleukin-8 and tumor necrosis factor alpha. These data suggest that DNA in IC of SLE patients will augment expression of ICAM-1 on endothelial cells, resulting in exacerbation of vasculitis.

Antigen-Antibody Complex↗

PubMed1996

A case of idiopathic portal hypertension complicated with narrowing of intrahepatic bile ducts.

A 37-year-old woman who had portal hypertension followed by splenomegaly, developed collateral blood flow of spleno-renal shunt and paraesophageal veins, esophageal varices and further with narrowing of intrahepatic bile ducts shown by endoscopic retrograde cholangiography was described. Liver function was almost normal except the slight elevation of serum alkaline phosphatase and gamma-glutamyl transpeptidase levels. However, endoscopic retrograde cholangiography revealed the narrowing of the intrahepatic bile ducts. The histological examination of biopsied specimen showed no prominent change in portal tracts and bile ducts without cell infiltration or fibrosis in the portal area. This case will be considered as idiopathic portal hypertension complicated by narrowing of the intrahepatic bile ducts.

Adult↗

PubMed1996

Periarticular ectopic calcinosis probably due to 1 alpha-OH-vitamin D3 therapy, and successful treatment with bisphosphonate compound in a patient with systemic lupus erythematosus.

We describe the case of a 25-year-old woman who developed soft tissue ectopic nephritis. Ectopic calcinosis rarely occurs in systemic lupus erythematosus (SLE) patients. This is the first detailed case report of metastatic ectopic calcinosis, one of two categories of ectopic calcinosis, probably due to 1 alpha-OH-vitamin D3 therapy. We administered disodium 3-amino-1-hydroxypropylidene-1, 1-bisphosphonate pentahydrate, a second-generation bisphosphonate, to decrease the patient's serum calcium level, and subsequently observed a dramatic decrease in severity of the ectopic calcinosis along with decreases in both the serum calcium level and the (serum calcium level)x(serum phosphate level) index. We suggest that 1 alpha-OH vitamin D3 should be used in cases of lupus nephritis with great caution.

Adult↗

PubMed1995

Lipoprotein(a) stimulates the proliferation of cultured human arterial smooth muscle cells through two pathways.

We investigated the effect of lipoprotein(a) (Lp(a)) on proliferation of human arterial smooth muscle cells (SMCs) and its mechanisms of action. Low density lipoprotein (LDL), Lp(a) and apolipoprotein(a) (apo(a)) significantly stimulated the proliferation of SMCs. Lp(a) and apo(a) reduced the amount of active transforming growth factor-beta (TGF-beta) with the mink lung epithelial cell bioassay, however LDL had no effect. Lp(a), but not apo(a), significantly stimulated the proliferation of SMCs even in the presence of a neutralizing antibody for TGF-beta. Our results suggest that Lp(a) stimulates the proliferation of SMCs via apo(a)-induced inhibition of TGF-beta activation and stimulation of SMCs by the LDL-particle of Lp(a).

Apolipoproteins A↗

PubMed1995

[Application of neurobehavioral tests in a manufacturing automotive parts factory].

Three neurobehavioral tests and a profile of mood states (POMS) test, which are included in the WHO neurobehavioral core test battery, were applied to 106 workers engaged in manufacturing automotive parts, especially for the purpose of determining the presence or absence of a significant difference in the score between a group of sixty-one workers chronically exposed to organic solvents and a group of forty-five workers unexposed. The scores of both pursuit-aiming and digit-symbol substitution tests were lower (P < 0.02 and P < 0.01, respectively, in analysis of covariance) in the group of exposed workers than in the group of unexposed workers. Furthermore, in the group of exposed workers, the pursuit-aiming and digit-symbol substitution scores showed a positive correlation (P < 0.05 and P < 0.01, respectively) to the fatigue score in the POMS test. On the other hand, the score of the digit span test showed no significant difference between the two groups. No significant correlation was found between the urinary hippuric acid level and the score of each of the three neurobehavioral tests. Therefore, among the exposed workers, the perceptual motor function evaluated in pursuit-aiming and digit-symbol tests seems to be affected. The neurobehavioral tests administered in this study are limited in number and in function, however, the comparison of their scores between the exposed and unexposed workers may suggest the presence of adversive effects of chronic exposure to organic solvents.

Adult↗

PubMed1995

Decreased atherosclerosis in mice deficient in both macrophage colony-stimulating factor (op) and apolipoprotein E.

To develop a murine model system to test the role of monocyte-derived macrophage in atherosclerosis, the osteopetrotic (op) mutation in the macrophage colony-stimulating factor gene was bred onto the apolipoprotein E (apoE)-deficient background. The doubly mutant (op/apoE-deficient) mice fed a low-fat chow diet had significantly smaller proximal aortic lesions at an earlier stage of progression than their apoE-deficient control littermates. These lesions in the doubly mutant mice were composed of macrophage foam cells. The op/apoE-deficient mice also had decreased body weights, decreased blood monocyte differentials, and increased mean cholesterol levels of approximately 1300 mg/dl. Statistical analysis determined that atherosclerosis lesion area was significantly affected by the op genotype and gender. The confounding variables of body weight, plasma cholesterol, and monocyte differential, which were all affected by op genotype, had no significant additional effect on lesion area once they were adjusted for the effects of op genotype and gender. Unexpectedly, there was a significant inverse correlation between plasma cholesterol and lesion area, implying that each may be the result of a common effect of macrophage colony-stimulating factor levels. The data support the hypothesis that macrophage colony-stimulating factor and its effects on macrophage development and function play a key role in atherogenesis.

Animals↗

PubMed1995

Manifestations of cancer cachexia induced by colon 26 adenocarcinoma are not fully ascribable to interleukin-6.

In order to further clarify the role of interleukin 6 (IL-6) in the pathogenesis of cachexia, recombinant human IL-6 (hIL-6) was administered s.c. by osmotic pump for 9 days at a dose of 1 or 10 micrograms/day into CDF1 mice inoculated with a non-cachexia-inducing subclone of colon 26 adenocarcinoma (clone 5), or with a cachexia-inducing subclone (clone 20) of this malignancy. The serum level of IL-6 in non-cachectic mice with clone-5 tumors was 35% lower than in cachectic mice bearing clone 20 of colon 26 adenocarcinoma on the 19th day after tumor inoculation. IL-6 administration induced anemia, thrombocytosis and visceral organ hypertrophy not only in mice with clone-5 tumors but also in control mice with no tumor burden. Lipolysis and proteolysis became conspicuous when a large dose (10 micrograms/day) of IL-6 was infused into mice with clone-5 tumors. However, IL-6 supplementation did not induce loss of body weight, a decline in food intake or lymphocytopenia, which were characteristically observed in cachectic mice with clone-20 tumors. In conclusion, IL-6 appears to be a permissive factor for the development of cachexia but, while it can induce some of the symptoms typical of cachexia, it cannot in itself induce the full cachectic syndrome.

Adenocarcinoma↗

PubMed1995

An effect of somatostatin on neurotensin secretion.

A somatostatin analog (SMS201-995) was administered subcutaneously to six totally pancreatectomized (TP) patients at five dose levels from 0 microgram/kg (control) to 2.5 micrograms/kg before ingestion of a liquid test meal, and plasma levels of neurotensin (NT) were measured. There were no significant differences in basal levels of NT between the doses of somatostatin. The NT levels were significantly elevated after ingestion of the test meal in the normal controls (n = 14). In the TP patients postprandial hypersecretion of NT was observed. The hypersecretion of NT in the patients was suppressed by SMS201-995 dose-dependently.

Adult↗

PubMed1995

Transcriptional elements directing a liver-specific expression of P450/6 beta A (CYP3A2) gene-encoding testosterone 6 beta-hydroxylase.

The P450/6 beta A (CYP3A2) gene encoding a testosterone 6 beta-hydroxylase is expressed predominantly in liver and induced by the treatment of rats with various compounds. To understand the mechanism of the basal transcriptional activation of the CYP3A2 gene, the cis-acting elements in the proximal promoter region (-165 to -73) of the CYP3A2 gene were identified in this study. Nuclear extract from rat livers interacted with three sites, 6 beta A-A (-106 to -87), 6 beta A-B (-140 to -119) and 6 beta A-C (-163 to -145). These sites were detectable by DNase I footprinting and gel mobility shift assays and found to share nucleotide sequence similarity with each other (T(A/C)(A/C)N(A/G)AAG(G/T)(C/T)CA). Direct repeats of AGTTCA (-134 to -120) and AG(G/C)TCA (-162 to -148) are also detected in 6 beta A-B and 6 beta A-C sites, respectively. To elucidate the relationship of these sites with basal transcriptional activation of the CYP3A2 gene, varying lengths of the proximal promoter region (-164 to +41) fused to a CAT reporter gene were transfected in human hepatoma (HepG2) and mouse adrenal tumor (Y-1) cells. The relative level of CAT activity in HepG2 cells was slightly increased by the deletion of the 5'-portion from -164 to -111 bp, but was reduced to 14% of the control (the construct including from -110 to +41) by the deletion from -110 to -81 including the 6 beta A-A site. On the other hand, these deletions have no clear effect on the level of the activity in Y-1 cells. Substitution mutations at two nucleotides in the 6 beta A-A site resulted in the reduction of CAT activity in HepG2 cells to 12% of the activity in the wild-type construct. The interaction of an oligonucleotide corresponding to the 6 beta A-A site (-106 to -87) with liver nuclear factors was completely inhibited by the addition of a typical oligonucleotide for hepatocyte nuclear factor-4 (HNF-4) binding site (F. M. Sladek, W. Zhong, E. Lai, and J. E. Darnell, Jr., 1990, Genes Dev. 4, 2353-2365) but not of oligonucleotides corresponding to 6 beta A-B or 6 beta A-C sites. These results suggest an essential role of the binding of HNF-4 and/or HNF-4-related nuclear factors to the 6 beta A-A site on the basal transcriptional activation of the CYP3A2 gene in liver cells.

Animals↗

PubMed1995

Cardiac involvement in mitochondrial diseases. A study on 17 patients with documented mitochondrial DNA defects.

BACKGROUND: Mutations of mitochondrial DNA have been demonstrated as causes of human mitochondrial diseases. While these disorders typically involve multiple organs, the effect of mitochondrial mutations on the heart has not been systematically studied. METHODS AND RESULTS: We studied mitochondrial mutations and cardiac changes in 17 patients with Kearns-Sayre syndrome; ocular myopathy; myoclonus epilepsy with ragged red fibers (MERRF); and mitochondrial myopathy, encephalopathy, lactic acidosis, and strokelike episodes (MELAS). Cardiac involvement was evaluated by chest radiograph, ECG, His-bundle electrogram, and echocardiogram. All 3 patients with Kearns-Sayre syndrome had large deletions of mitochondrial DNA and disturbances in cardiac conduction. ECG abnormalities were found in 2 of 6 patients with ocular myopathy who showed large deletions of mitochondrial DNA. All 3 patients with MERRF had an A-to-G mutation at nucleotide position 8344; 2 had cardiomegaly, asymmetrical septal hypertrophy, and diffuse hypokinesis of the left ventricle. One patient with asymmetrical septal hypertrophy developed dilated cardiomyopathy 2 years later. All 5 patients with MELAS had an A-to-G mutation at nucleotide position 3243, and 2 had symmetrical left ventricular hypertrophy with or without abnormal wall motion. CONCLUSIONS: The clinical features of cardiac involvement in mitochondrial diseases vary in the different subgroups of these disorders. Particular mitochondrial mutations can cause characteristic cardiac abnormalities.

Adult↗

PubMed1995

Immune function in patients undergoing open vs laparoscopic cholecystectomy.

Explore the source record for details and available documents.

Adrenocorticotropic Hormone↗