Effect of ethane-1-hdryoxy-1, 1-diphosphonate (EHDP) on fetal mice during pregnancy. Chemical changes in skin collagen.
Explore the source record for details and available documents.
Animals↗
Biomedical subjects
M Miwa
Publications and source records attributed to M Miwa.
[Effects of experimental amblyopia on the visual behavior, ocular axial length, refraction and morphological properties of retinal ganglion cells].
Explore the source record for details and available documents.
Amblyopia↗
N-nitrosamine formation by macrophages.
Nitrate biosynthesis is a known mammalian process, and macrophages from mice treated with Escherichia coli lipopolysaccharide (LPS) have been shown to be capable of nitrate synthesis. Cell culture studies showed that macrophages produce nitrite as well as nitrate. We report here N-nitrosamine formation by stimulated macrophages. Experiments were carried out with the macrophage cell lines, J774.1, WEHI-3 and RAW 264. Macrophages were cultured in Dulbecco's modified Eagle's medium (pH 7.5) supplemented with calf serum (10%). The concentration of nitrate in the supernatant was measured. N-nitrosamines were extracted with dichloromethane and the extracts were analysed by gas chromatography-thermal energy analysis. When J774.1 (1.5 X 10(6) cells/ml) were incubated with LPS (10 micrograms/ml) and morpholine (15 mM) for 72 h at 37 degrees C, N-nitrosomorpholine (NMOR) was produced (0.8 microM). The amount of nitrite produced was 50 microM. RAW 264 and WEHI-3 also produced NMOR; LPS was required for nitrite and NMOR formation. gamma-Interferon (IFN) promoted both NMOR (2.5 microM) and nitrite (70 microM) formation. Nitrite (150 microM) incubated with morpholine and the medium did not form NMOR. Kinetics of LPS-induced nitrite and NMOR formation in J774.1 showed that the rate of NMOR formation was highest in the middle incubation period (24-36 h), although the nitrite concentration was highest in the latter incubation period (48-60 h). Our results showed that macrophages may be capable of nitrosamine formation under physiological conditions that do not normally permit this reaction.
Animals↗
Identification of p26Xb and p24Xb of human T-cell leukemia virus type II.
Human T-cell leukemia virus type II (HTLV-II) isolated from a T-cell variant of hairy cell leukemia contains gag, pol and env genes as well as a fourth gene termed X, which can code three major open reading frames Xa, Xb and Xc. Proteins with molecular masses of 26 kDa (p26Xb) and 24 kDa (p24Xb) encoded by the Xb open reading frame were identified with antisera directed against synthetic peptides corresponding to the N-terminal and C-terminal amino acid sequences deduced from the structure of the Xb open reading frame. More than half the Xb products were found to be located in the nuclear fraction of HTLV-II-infected cells.
Antigen-Antibody Complex↗
Detection of the X gene product of simian T-cell leukemia virus.
The gene product of the X region was examined in simian lymphoid cell lines producing simian T-cell leukemia virus (STLV), which is closely related to human T-cell leukemia virus (HTLV). By use of specific antibodies against pX peptides of HTLV-I, a protein of 41 kDa was identified as a pX product of STLV.
Animals↗
Quantitative fluorographic detection of 3H and 14C on two-dimensional thin-layer chromatographic sheets by an ultra-high-sensitivity TV camera system.
A method for quantitative detection of 3H and 14C on thin layers is described. After impregnation of the TLC sheet with 50% 2,5-diphenyloxazole-tetrahydrofuran, quantitative imaging of the distribution of weak beta-ray-emitting isotopes on the chromatogram was carried out at room temperature by using a TV camera system, which consisted of a two-stage microchannel plate image intensifier, a low-lag vidicon, and an image processor. The method is applicable for 14C- and 3H-labeled samples on TLC sheets (10 X 10 cm) emitting more than 0.17 and 7.5 Bq/mm2, respectively. The method is rapid and has a dynamic range far greater than that of film.
Autoradiography↗
Adult T-cell leukemia/lymphoma not associated with human T-cell leukemia virus type I.
We describe five patients with adult T-cell leukemia/lymphoma (ATL) with neither integration of human T-cell leukemia virus type I (HTLV-I) into their leukemia cells nor anti-HTLV-I antibody in their sera. These findings indicate that HTLV-I may not have been involved in leukemogenesis in these patients. The clinicohematological, cytopathological, and immunological features of HTLV-I-negative ATL were exactly the same as those of HTLV-I-associated ATL. Leukemia cells with pleomorphic nuclei, generalized lymphadenopathy, hepatosplenomegaly, skin lesions, hypercalcemia, and elevated lactate dehydrogenase levels, all of which are characteristic features of typical ATL, were also seen in these patients with HTLV-I-negative ATL. Leukemia cells expressed T3, T4, and pan-T-cell antigens in three cases, and T3 and pan-T-cell antigens in two. All five patients had lived in ATL-nonendemic areas. The finding of HTLV-I-negative ATL suggests that factor(s) other than HTLV-I infection may be involved in ATL leukemogenesis.
Adult↗
Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T-cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription.
The cis-acting regulatory sequence of transcription from long terminal repeats (LTRs) of human T-cell leukemia virus type I and type II (HTLV-I and HTLV-II), which is essential for action of the virally encoded trans-acting transcriptional factor(s) designated pX(s), in HTLV-I and -II was identified. Deletion of most of the U3 region of the HTLV-I LTR resulted in loss of trans-acting transcriptional activation. However, when a tandem repeat of a 21-nucleotide sequence (GAAGGCTCTGACGTCTCCCCC) that is present in the U3 region of HTLV-I and -II LTRs was inserted into the deleted U3 region of the HTLV-I LTRs, chloramphenicol acetyltransferase activity was restored. The extent of restoration of activity was proportional to the number of copies of the sequence inserted. To test the possibility that the 21-nucleotide sequence alone is necessary for trans-activation, a sequence (AGGAACTGAAA) homologous to a type-specific viral enhancer sequence and present in the U3 region of HTLV-II LTR, but not in the same region of the HTLV-I LTR, was inserted together with the 21-nucleotide sequence into the deleted U3 region of the HTLV-I LTR. However, no significant differences of the levels of activities of those LTRs compared to the LTRs with only the 21-nucleotide sequence repeats were observed.
Acetyltransferases↗
Enzymatic cleavage of various fluorinated pyrimidine nucleosides to 5-fluorouracil and their antiproliferative activities in human and murine tumor cells.
Explore the source record for details and available documents.
Animals↗
Structure of HTLV and its biological function in leukemogenesis of adult T-cell leukemia.
There is a high homology of nucleotide sequence between 3' two-thirds of the X (or pX) regions of human T-cell leukemia virus (HTLV)-I, and of HTLV-II. Monoclonal antibody against p41 coded from X-IV, an open reading frame of X region of HTLV-I, was established. Two proteins coded by Xb, one of the open reading frames in X region of HTLV-II, were newly identified as p24 and p26. The expression of X protein of HTLV-II in the reconstituted mouse embryonal carcinoma cell line, which shows myoblastic morphology, reverted the morphology to that of the original embryonal carcinoma cells. This suggests that the function of X protein is to disturb the regulation of cell lineage determination. Leukemogenesis of adult T-cell leukemia (ATL) is also considered to consist of multisteps, in which HTLV-I constitutes one step, other factors also being involved. Even the role of HTLV-I factor could be similarly played by other factor(s). In agreement with this hypothesis, there are patients with ATL without associated HTLV-I.
Adult↗
Monoclonal antibody NCC-pX-1G reactive with gene products coded from X regions of human T-cell leukemia virus.
Monoclonal antibody NCC-pX-1G (IgG1, kappa) was obtained by the hybridoma technique by immunization of mice with the C-terminal 54 amino acids of the pX protein, made from the 3'-terminal portion of the pX gene conjugated with bovine growth hormone gene transfected in E. coli. NCC-pX-1G recognized 41 kilodalton pX protein of HTLV-I, and immunocytochemically stained HUT102 and other HTLV-I-infected cell lines, but no reaction was observed with non-HTLV-I-infected cell lines or normal human tissue cells.
Animals↗
Complex of subtilisin BPN' with Streptomyces subtilisin inhibitor. Complex formation concomitant with change in reducibility of disulfide bonds in the inhibitor.
Structure of the complex of Streptomyces subtilisin inhibitor (SSI) with subtilisin BPN' was studied by examining the thermal denaturation and reducibility of disulfide bonds. The denaturation temperature of the complex was significantly higher than that of the enzyme. Two disulfide bonds localized in the inhibitor side were completely reduced in the complex, whereas only one of them was reduced in the free SSI. Gel filtration of the reduced complex solution showed clearly that the main products of reduction of the complex were two peptide fragments of SSI divided at the active site. The resistive disulfide bond in the complexed inhibitor became accessible as a result of a large conformational change due to splitting of the half-reduced inhibitor.
Bacterial Proteins↗
Human T-cell leukemia virus type I: pseudotype neutralization of Japanese and American isolates with human and rabbit sera.
CCC/2M, CCC/10Y and CCC/MT-2 cat kidney cells producing Japanese isolates of human T-cell leukemia virus type I (HTLVs) and HOS/PL human osteosarcoma cells producing an American isolate of HTLV were infected with vesicular stomatitis virus (VSV) to prepare VSV pseudotypes bearing envelope antigens of HTLVs. VSV propagated in CCC/2M cells contained plaque-forming fractions that were not neutralized by treatment with anti-VSV serum alone: VSV pseudotypes bearing envelope antigens of HTLV2M and CCC cat endogenous virus were formed by infection of CCC/2M cells with VSV. Japanese HTLV2M, HTLV10Y and HTLVMT-2 and American HTLVPL pseudotypes were neutralized by sera of Japanese, American and British patients with ATL. Each serum, including the serum of the patient from whom HTLV2M or HTLV10Y had been derived, gave similar antibody titers against Japanese and American HTLV pseudotypes. The HTLV pseudotypes were also neutralized by rabbit serum raised against HTLVMT-2. A rabbit antiserum against the C-terminal half of the HTLV env protein produced in E. coli also neutralized Japanese and American HTLV pseudotypes. Thus, VSV pseudotype analyses indicated that envelope antigens of HTLVs represent a single serotype worldwide. The env protein produced in E. coli may be used to raise neutralizing antibody against HTLVs.
Acute Disease↗
Methylation pattern of human T-cell leukemia virus in vivo and in vitro: pX and LTR regions are hypomethylated in vivo.
The methylation patterns of the gag, pol, env, pX and LTR regions of proviral DNA of human T-cell leukemia/lymphoma virus type I (HTLV) in fresh leukemic cells and established cell lines were examined using HpaII/MspI endonuclease. Peripheral blood lymphocytes (PBL) isolated from patients with adult T-cell leukemia/lymphoma (ATL) did not express viral antigens of HTLV, but PBL that had been cultured for 2 days did express these viral antigens. Most parts of the gag, pol and env regions of the HTLV provirus in PBL isolated from 12 ATL patients and PBL cultured for 2 days were hypermethylated as reported by others. In contrast, in 10 established cell lines that harbored HTLV genomes and expressed viral antigens, HTLV proviruses were hypomethylated. In one cell line, ATL-IK, which harbored an HTLV genome but did not produce viral antigens, the gag, pol and env regions were hypermethylated. However, two HpaII sites, one in the middle of the gag region and the other in the middle of the pol region, were not methylated even in PBL from most ATL patients. Furthermore, the pX and LTR regions were hypomethylated not only in established cell lines but also in PBL of ATL patients. The hypomethylation of the pX and LTR regions detected in fresh leukemic cells of ATL patients may have some etiological significance in cell transformation by controlling the level of transcription of these regions, or modulating the binding of some factors to these regions.
Adult↗
Transmission of human T-cell leukemia virus type I to an S+L- cat kidney cell line.
The S+L- cat kidney cell line CCC was cocultivated with lethally irradiated human lymphoid cell lines that were producing human T-cell leukemia virus type I (HTLV-I). Eight of nine S+L- CCC sublines that had been cocultivated with nine different HTLV-producing T-cell lines gave positive reactions for HTLV antigens by indirect immunofluorescence assay. One subline CCC/2M was cloned. The percentages of fluorescent cells differed markedly in different sublines and clones. Southern blot hybridization with HTLV probes and electrophoresis of immunoprecipitates indicated that defective HTLVs were often transmitted into S+L- cat cells. S+L- CCC cells were permissive for HTLV and the properties of HTLV-infected cat cells were heterogeneous.
Animals↗
Complete nucleotide sequence of an infectious clone of human T-cell leukemia virus type II: an open reading frame for the protease gene.
The entire nucleotide sequence of an infectious clone of human T-cell leukemia virus type II provirus was determined. This provirus consists of 8952 nucleotides. In addition to long terminal repeats and gag, pol, env, and X, a protease gene that is responsible for processing the gag precursor protein was found. The protease gene is encoded in a different frame from gag and pol and was located between the gag and pol open reading frames. The 5' region of the protease gene overlaps the 3' gag region. Coding regions of the provirus show about 60% homology with those of human T-cell leukemia virus type I at the nucleotide level. The evolutionary relationship between human T-cell leukemia virus types I and II is discussed.
Antigens, Viral↗
Identification of new gene products coded from X regions of human T-cell leukemia viruses.
Antibodies were raised against oligopeptides deduced from the nucleotide sequence in the conserved region located between env and the 3' long terminal repeat in human T-cell leukemia virus type I (HTLV-I) and type II (HTLV-II) to detect a protein coded from this region in virus-infected cells. Two of these antibodies precipitated a protein of 41 kilo-daltons in HTLV-I-infected cell lines and a protein of 38 kilo-daltons in HTLV-II-infected cells. The protein in HTLV-I-infected cells was precipitated by plasma from patients with adult T-cell leukemia but not by plasma from a normal adult. These results indicate that these proteins were translated from new coding regions (X) present in HTLV-I and HTLV-II.
Base Sequence↗
Studies on phospholipase A inhibitor in blood plasma. II. Interaction of phospholipase A inhibitor with phospholipase A and its specificity.
Non-competitive inhibition of snake venom phospholipase A2 which has been exhibited by bovine plasma phospholipase A inhibitor, a kind of lipoprotein, was not observed unless the inhibitor was preincubated with the enzyme. The inhibition seemed to be due to the formation of the enzyme-inhibitor complex, which was identified by immunoelectrophoresis. The enzyme-inhibitor interaction was observed maximally on incubation at physiological pH, but not below pH 5. The inhibitor was inactivated by trypsin digestion and heat treatment. It suppressed the phospholipase A2 activities of rat blood plasma as well as of the snake venom and porcine pancreas, but not the enzyme activities such as those of phospholipase C of Bacillus cereus, lipase of porcine pancreas, trypsin, and papain. The inhibitor also showed the ability to decrease membrane-bound phospholipase A1 and A2 activities in intracellular organelles such as plasma membranes, mitochondria, lysosomes, and microsomes. In view of these facts, it was concluded that the plasma inhibitor is specific for phospholipase A.
Animals↗