Search PubMed⌕ Search

Biomedical subjects

M Kusuda

Publications and source records attributed to M Kusuda.

At least 19 recordsLinked to original sources
PubMed2000

First isolation of Exophiala dermatitidis from a dog: identification by molecular analysis.

The present study deals with the first isolation of Exophiala dermatitidis from a dog. The dog had a history of multicentric lymphoma for 4 months. On physical examination, 10-15 black or purple subcutaneous nodules were detected on the dorsum of the right neck. Microscopic examination of biopsy specimen from the nodules disclosed lymphocytes, neutrophils and moniliform hyphae. The colony of the clinical isolate was flat with black aerial hyphae and a wet margin after 2 weeks incubation on Sabouraud's dextrose agar at 27 degrees C. The microscopic examination of the clinical isolate revealed that hyphae were brown, septate, and smooth, producing branched or unbranched conidiospores laterally or on the apex. The conidia were one celled, subglobose, elliptical to cylindrical, smooth and hyaline. Nucleotide sequence analysis of the chitin synthase 2 (CHS2) gene fragments from the isolate and a reference strain of E. dermatitidis showed more than 99% similarity.

Animals↗
PubMed2000

Characterization and expression of a Neurospora crassa ribosomal protein gene, crp-7.

We have isolated and characterized a Neurospora crassa cytoplasmic ribosomal protein gene, named crp-7, which is found upstream of the photolyase gene. The deduced amino-acid sequence of this gene is highly homologous to the YS25 ribosomal protein of Saccharomyces cerevisiae. The crp-7 ORF consists of two exons which are separated by a short intron. The deduced polypeptide contains 87 amino acid residues and has a calculated molecular weight of 9.7 kDa. RFLP mapping showed that the crp-7 gene is located on the right arm of linkage group I. Southern blot hybridization analyses indicated that there is only one copy of the crp-7 gene in the N. crassa genome. Transcriptional elements, the Dde box, the Taq box and the CG element, that have been identified in other N. crassa ribosomal protein genes are observed in the promoter region of the crp-7 gene. The crp-7 mRNA levels were low in conidia and highest in young mycelia during vegetative growth. The mRNA levels of four r-protein genes, including the crp-7 gene, as well as the tef-1 gene encoding translational elongation factor 1 alpha, were raised following the treatment of mycelia with a low concentration of cycloheximide. This indicates that the expression of r-protein genes is under the control of so-called super-induction.

Amino Acid Sequence↗
PubMed1998

A comparison of epidemiologic, histologic, and virologic studies on Hodgkin's disease in western Kenya and Nagasaki, Japan.

Rapid progress in molecular technologies has enabled the detection of several oncogenic viruses in various types of tumors. The pathogenesis of Hodgkin's disease is suggested to have a strong association with Epstein-Barr virus (EBV). However, Hodgkin's disease related to EBV shows a wide geographic variation in epidemiology. These variations among different populations suggest an interaction of environmental factors and a direct role of EBV infection. Therefore, we performed a comparative study on epidemiologic, histologic, and virologic features of Hodgkin's disease among those in the western part of Kenya and in Nagasaki, Japan. The age distribution of Hodgkin's disease showed a distinct peak in the 0-9-year-old age group in Kenya, and a higher and lower peak in the 60-69- and 30-39-year-old age groups, respectively, in Japan. The most common subtype of Hodgkin's disease in both countries was mixed cellularity, followed by nodular sclerosis, lymphocyte depletion, and lymphocyte predominance. Mixed cellularity showed a significantly high prevalence among Kenyan children nine years of age or younger. Using the in situ hybridization method, EBV-encoded RNA (EBER-1) was detected in 79% of the Kenyan cases and 59% of the Japanese cases, with the mixed cellularity subtype showing a strong correlation with EBER-1. There was 100% positivity in both countries in those less than nine years old. These results suggest that EBV plays a more direct role in the pathogenesis of Hodgkin's diseases in Kenya, especially in cases among young children and also in Japanese children. Environmental and/or genetic factors may have a role, in addition to EBV, in the pathogenesis of Hodgkin's disease, especially in Nagasaki, Japan.

Adolescent↗
PubMed1996

Relation of C4b-binding protein to athero-sclerosis of the descending thoracic aorta.

C4b binding protein (C4bp) is a regulator of the classical pathway of the complementing system. It forms a complex with protein S which serves as a cofactor of coagulation inhibitor, protein C. We have reported that C4bp is an acute phase reactant and associated with total cholesterol and triglyceride concentrations (Biochim. Biophys. Acta 963 (1988) 98-108). This suggests a possible association of C4bp with athero-sclerosis. We examined the relation of C4bp levels and the severity of atherosclerosis of the descending thoracic aorta in 98 Japanese men. The severity of aortic atherosclerosis was assessed by average sclerotic length (ASL) and average sclerotic area (ASA), using transesophageal echocardiography. After adjustment for age, C4bp levels increased significantly with increasing ASL and ASA. The association remained significant even after adjusting for total cholesterol, hypertension, smoking, drinking, body mass index, fasting blood sugar, and uric acid. Immunohistochemical analysis of specimens of the descending thoracic aorta from autopsies, demonstrated the presence of C4bp in the foamy macrophages of fatty streaks and the necrotic core of atheromatous plaque. These findings indicate that the serum level of C4bp can serve as an independent indicator of aortic athero-sclerosis.

Adult↗
PubMed1996

Clinico-pathological predictive factors of response to interferon therapy in chronic hepatitis C.

We performed a clinico-pathological study to determine which pre-treatment factors could predict the response to interferon (IFN) therapy in 55 Japanese patients with chronic hepatitis C. Responses to the IFN therapy were evaluated as sustained response, relapse and non-response by the presence or absence of serum hepatitis C virus (HCV) RNA during the course of treatment and at least 6-months post-treatment. The numbers of sustained response, relapse and non-response were 16 (29.0%), 25 (45.5%) and 14 (25.5%), respectively. Eight out of 16 sustained response cases (50%) showed HCV genotype III. Eight among 10 patients with HCV genotype III (80%) were sustained responders. HCV genotypes were found to be correlated with the response to the IFN therapy (p < 0.0001). None of the histological features, the types of the IFN therapy and other clinical factors showed significant differences. These findings suggest that outcome of the IFN therapy in chronic hepatitis C can be predicted by a virological factor, and that HCV genotype III is a useful predictor of a favorable outcome.

Biopsy↗
PubMed1992

A simple method to assess osteoclast-mediated bone resorption using unfractionated bone cells.

To determine osteoclastic bone resorption we established a simple assay system in which unfractionated cells obtained from femora of 13-day-old mice were cultured on a dentine slice and the number of osteoclasts and their induced pit area on the slices were measured. When the bone cells (1 x 10(5) cells/dentine slice) were cultured in the presence of 1,25-dihydroxyvitamin D3 [1,25(OH)2D3] or human parathyroid hormone (hPTH) for 4 days, at which time newly-formed osteoclasts were not detected, the pit area was dose-dependently increased, being a 4.3- or 4.1-fold respective increase over the control at a 10(-8) M concentration of hormones. Chick calcitonin (cCT) inhibited the osteoclastic bone resorption induced by either of these hormones. cCT alone also suppressed the bone resorption by the cells (3 x 10(5) cells/dentine slice). These findings indicate that 1,25(OH)2D3 or hPTH may mainly activate pre-existing osteoclasts, resulting in increased bone resorption, and that cCT may suppress this osteoclastic activity. When 1,25(OH)2D3 or hPTH was added to the cells pre-cultured in factor-free medium for 6 days, at which time pre-existing osteoclasts had almost degenerated, new osteoclasts were formed, resulting in an increase in pit formation. Thus this system is a useful method which could more sensitively evaluate the effects of hormones or factors on osteoclast formation and activation than other previous systems.

Animals↗
PubMed1991

Murine recombinant leukemia inhibitory factor modulates inhibitory effect of 1,25 dihydroxyvitamin D3 on alkaline phosphatase activity in MC3T3-E1 cells.

We demonstrated murine leukemia inhibitory factor (mLIF) mRNA in osteoblastic MC3T3-E1 cells, but not mLIF in their conditioned medium. Recombinant mLIF had an inhibitory effect on alkaline phosphatase (ALP) activity, but not on DNA synthesis, in these mLIF-free cells. This inhibitory effect was not prostaglandin E2 dependent. mLIF also modulated the inhibitory effect of 1,25 dihydroxyvitamin D3 [1,25(OH)2D3] on ALP activity, partly via down regulation of 1,25(OH)2D3 binding sites. These results suggest that LIF may play a role in regulating osteoblast differentiation.

Alkaline Phosphatase↗
PubMed1989

Expression of Ia antigen by ocular tissues of mice treated with interferon gamma.

Intraperitoneal injections of interferon gamma (IFN-gamma) induced or enhanced the expression of Ia antigen by selected murine ocular tissues. In contrast, topical application of this lymphokine had no effect. Ia antigen expression was noted in most cellular components of the conjunctiva, iris, ciliary body, choroid and sclera of treated mice. Intense staining was also found in stromal cells of the cornea, but no Ia reactivity was detected in the corneal epithelium. The lack of staining in the corneal epithelium is in contrast to the strong reactivity in the adjacent conjunctival epithelium, as well as in the skin epithelium. There was no increase in the number of Langerhans cells in the peripheral cornea and limbus, or in their intensity of staining with the anti Ia antibodies. The pattern of Ia expression in ocular tissues of mice treated with IFN-gamma is similar to that of rats with experimental autoimmune uveoretinitis (EAU) except that Ia is expressed more regularly and with higher intensity by the retinal vascular endothelium of rats with EAU than by that of IFN-gamma-treated mice. The findings in the current study thus support the notion that IFN-gamma may be involved in immune-mediated inflammation in the eye.

Animals↗
PubMed1989

Cryopexy enhances experimental autoimmune uveoretinitis (EAU) in rats.

Treatment of rat eyes with cryopexy enhanced the development of experimental autoimmune uveitis (EAU) in these eyes. The enhancement of EAU by cryopexy was particularly pronounced when the disease was induced by active immunization in rats of a low responder strain (Wistar Furth), or by adoptive transfer with lymphocytes sensitized against S-antigen. The disease enhancement was expressed by earlier onset of clinical symptoms and by more severe inflammatory changes. Histological examination of cryopexy-treated eyes showed focal necrosis and inflammation, confined to the affected sites. Immunohistochemical analysis of the inflammatory infiltration revealed it consists mainly of macrophages and T-lymphocytes of the helper and suppressor subsets. In addition, increased expression of class II antigens was observed in affected areas, on both inflammatory and resident ocular cells. Using electron microscopy and Evans blue angiography we could show breakdown of the blood-retinal barrier at the treated sites. Histological examination of eyes with EAU following cryopexy showed localization of the early inflammation at the injured site. The data are interpreted to suggest that the enhanced EAU in cryopexy-treated eyes is mainly due to the breakdown of the blood-retinal barrier, the accumulation of lymphoid cells and the increased expression of class II antigens, which facilitates antigen presentation.

Animals↗
PubMed1982

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

Base Sequence↗
PubMed1982

The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

Base Sequence↗
PubMed1982

Infertility and metroplasty.

Various techniques of metroplasty were performed in 32 cases of double uterus. In these patients the fetal survival rate before the operation was nil, whereas post-operatively it reached as high as 92.6%. Strassmann's operation was carried out in 16 cases, Jones & Jones's modified method in 12 cases and Tompkins's operation in 4 cases. The merits and demerits and the applicability of each technique and the various types of uterine malformation are discussed. It is concluded that a correct diagnosis of uterine malformation can only be established by a combination of precise HSG with direct macroscopical observation of uterine body. The Strassmann transverse incision is well suited for a bicornuate uterus, and Jones & Jones's wedge-shaped fundal resection for a partial septate uterus. The postoperative deformation in the fundus uteri is most frequently seen after the application of Strassmann's method, and is much less common with the modified method of Jones & Jones. Metroplasty can be applied in such cases of uterine malformation as when primary sterility is complained of but where any other cause for sterility is ruled out or is deemed to be corrected. Maximum care should be taken to prevent postoperative adhesion. Three months is considered to be a sufficient period for postoperative contraception. The mode of delivery depends on the individual case, though cesarean section is recommended.

Abortion, Habitual↗
PubMed1982

Induction of LH surge with estradiol benzoate and its clinical significance in anovulatory women.

In order to investigate the hypothalamic function of anovulatory women serial determinations of the serum gonadotropins (LH and FSH) were made over a period of 120 h following the intramuscular injection of 1 mg of estradiol benzoate (E.B.). Ten women with normal menstrual cycles and 57 anovulatory women were subjected to this study. The positive release of LH in serum (exceeding at least 150% of basal level) in response to E.B. was noted in follicular phase of the cycles, but not in luteal phase, and in 31 of 57 patients the release came between 48 to 96 h after the E.B. injection. The LH surge after E.B. injection was difficult to provoke when the basal serum LH and estradiol (E2) levels were low: less than 10 mIU/ml and 50 pg/ml, respectively. Thirteen of 27 patients, who showed LH surge, ovulated because of Clomid. Only three of 17 patients, who did not show LH surge, ovulated as a response to Clomid. Ten of 14 patients, who showed LH surge after E.B. but did not ovulate after Clomid, revealed a polycystic ovarian disease (PCO), and the responsiveness to both E.B. and Clomid improved after wedge-resection of the ovaries. These results suggest that the serum E2 level is closely correlated to the ability for LH-RH production in the hypothalamic "surge center," and that the E.B. provocation test is useful for investigating the hypothalamic function of anovulatory women and for diagnosing preoperatively the PCO resistant to Clomid treatment.

Adult↗
PubMed1982

[Studies on the classification of endometriosis].

A new classification system of endometriosis proposed by the American Fertility Society (AFS classification) was utilized to categorize patients with endometriosis after surgical treatment and the following results were obtained. 1. AFS classification system was useful to categorize patients with endometriosis, because of a simple and objective point system. 2. There were discrepancies in categorized patients between AFS system and a system proposed by Acosta et al. (Acosta's system). One-third of patients categorized as "Severe" by Acosta's system was classified to be "Moderate" by AFS system. These discrepancies occurred when lesion of endometriosis was just restricted within ovaries. 3. Conception was reduced once ovaries were involved and fecundability rate was significantly reduced if ovarian endometrioma was greater than 3cm in diameter. 4. Acosta's system revealed differences among fecundability rate among the different categories, however, AFS system could not demonstrate a direct correlation between the categories of endometriosis and fecundability rate.

Adult↗