Search PubMed⌕ Search

Biomedical subjects

M Kataoka

Publications and source records attributed to M Kataoka.

At least 37 records · Page 2Linked to original sources
PubMed2001

Lactone-ring-cleaving enzymes of microorganisms: their diversity and applications.

Microbial lactonohydrolases (lactone-ring-cleaving enzymes) with unique characteristics were found. The Fusarium oxysporum enzyme catalyzes the reversible and stereospecific hydrolysis of aldonate lactones and D-pantolactone (D-PL), and is useful for the optical resolution of racemic PL. The Agrobacterium tumefaciens enzyme hydrolyzes several aromatic lactones, and catalyzes the stereospecific hydrolysis of PL like the Fusarium enzyme, but its selectivity is opposite. The Acinetobacter calcoaceticus enzyme catalyzing the specific hydrolysis of dihydrocoumarin belongs to serine-enzyme family, and is useful for enantioselective hydrolysis of methyl DL-beta-acetylthioisobutyrate and regioselective hydrolysis of methyl cetraxate. This enzyme also catalyzes the bromination of monochlorodimedon when incubated with H(2)O(2) and dihydrocoumarin.

Acinetobacter calcoaceticus↗
PubMed2001

Spectroscopic characterization of the photocycle intermediates of photoactive yellow protein.

The absorption spectra of photocycle intermediates of photoactive yellow protein mutants were compared with those of the corresponding intermediates of wild type to probe which amino acid residues interact with the chromophore in the intermediate states. B and H intermediates were produced by irradiation and trapped at 80 K, and L intermediates at 193 K. The absorption spectra of these intermediates produced from R52Q were identical to those from wild type, whereas those from E46Q and T50V were 7-15 nm red-shifted as those in the dark states. The absorption spectra of M intermediates were measured by flash photolysis at room temperature. Those of Y42F, T50V, and R52Q were identical to that of wild type, whereas that of E46Q was 11 nm red-shifted. Assuming that the intermediates of mutants have a structure comparable to that of wild type, these findings suggest the following: Glu46 interacts with the chromophore throughout the photocycle, interaction between the chromophore and Thr50 as well as Tyr42 is lost upon the formation of M intermediate, and Arg52 never interacts with the chromophore directly. The hydrogen-bonding network around the phenolic oxygen of the chromophore would be thus maintained until L intermediate decays, and the global conformational change would take place by the loss of the hydrogen bond between the chromophore and Tyr42. This model conflicts with some of the results of previous crystallographic studies, suggesting that the reaction mechanism in the crystal may be different from that in solution.

Amino Acids↗
PubMed2001

Stability of blood carbon monoxide and hemoglobins during heating.

The effects of heating on hemoglobin (Hb) and carbon monoxide (CO) levels in human blood were investigated by in vitro experiments. Head-space gas chromatography (HS-GC) using a molecular sieve 5A stationary phase and thermal conductivity detection was adopted for the measurement of CO gas, and spectrophotometric methods were used for the measurement of various Hb forms, protein and heme contents. Deteriorated absorbance spectra were observed for heat-treated blood samples, and double wavelength spectrophotometry was proven to give wrong percent saturation of carboxyhemoglobin content (% CO-Hb). The blood sample taken from one fatal fire casualty gave significantly higher % CO-Hb measured spectrophotometrically, compared to that by HS-GC. Control blood or purified Hb solution, which was saturated with CO in designated extent, was heated in a sealed vial. Under the incubation below 54 degrees C, all Hb forms were stable, except for oxyhemoglobin (Hb-O(2)), which was partially oxidized to met-hemoglobin (Met-Hb). In contrast, under the incubation at 65 degrees C, Met-Hb was denatured completely to be insoluble, and Hb-O(2) was partially denatured via Met-Hb formation. CO-Hb was resistant against heating. The difference of heat susceptibility and precipitability among Hb forms resulted in artificial increase of % CO-Hb. During heating, spontaneous CO was produced from blood.

Carbon Monoxide↗
PubMed2001

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method.

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).

DNA↗
PubMed2001

Low-temperature Fourier transform infrared spectroscopy of photoactive yellow protein.

The photocycle intermediates of photoactive yellow protein (PYP) were characterized by low-temperature Fourier transform infrared spectroscopy. The difference FTIR spectra of PYP(B), PYP(H), PYP(L), and PYP(M) minus PYP were measured under the irradiation condition determined by UV-visible spectroscopy. Although the chromophore bands of PYP(B) were weak, intense sharp bands complementary to the 1163-cm(-1) band of PYP, which show the chromophore is deprotonated, were observed at 1168-1169 cm(-1) for PYP(H) and PYP(L), indicating that the proton at Glu46 is not transferred before formation of PYP(M). Free trans-p-coumaric acid had a 1294-cm(-1) band, which was shifted to 1288 cm(-1) in the cis form. All the difference FTIR spectra obtained had the pair of bands corresponding to them, indicating that all the intermediates have the chromophore in the cis configuration. The characteristic vibrational modes at 1020-960 cm(-1) distinguished the intermediates. Because these modes were shifted by deuterium-labeling at the ethylene bond of the chromophore while labeling at the phenol part had no effect, they were attributed to the ethylene bond region. Hence, structural differences among the intermediates are present in this region. Bands at about 1730 cm(-1), which show that Glu46 is protonated, were observed for all intermediates except for PYP(M). Because the frequency of this mode was constant in PYP(B), PYP(H), and PYP(L), the environment of Glu46 is conserved in these intermediates. The photocycle of PYP would therefore proceed by changing the structure of the twisted ethylene bond of the chromophore.

Bacterial Proteins↗
PubMed2001

Direct observation of three conformations of MutS protein regulated by adenine nucleotides.

Mismatched base-pairs, which are caused by either DNA replication errors, DNA damage or genetic recombination, are repaired by the mismatch-repair system. The MutS protein, a component of the mismatch-repair system, recognizes mismatched base-pairs in DNA, and its DNA-binding activity is affected by ATP and ADP. Here, we show that the MutS protein from Thermus thermophilus HB8 can have three different conformations in solution, based on direct observations made by small-angle X-ray scattering. The conformation of MutS in solution is drastically influenced by the presence of ADP and ATP; the ATP-bound form has the most compact conformation, the ADP-bound form the most stretched, and the nucleotide-free form has a conformation intermediate between the two. Based on these findings, we conclude that the DNA-binding activity of MutS may depend on conformational changes triggered by both the binding and hydrolysis of ATP.

Adenosine Diphosphate↗
PubMed2001

Primary photoreaction of photoactive yellow protein studied by subpicosecond-nanosecond spectroscopy.

The primary photochemical event of photoactive yellow protein (PYP) was studied by laser flash photolysis experiments on a subpicosecond-nanosecond time scale. PYP was excited by a 390-nm pulse, and the transient difference absorption spectra were recorded by a multichannel spectrometer for a more reliable spectral analysis than previously possible. Just after excitation, an absorbance decrease due to the stimulated emission at 500 nm and photoconversion of PYP at 450 nm were observed. The stimulated emission gradually shifted to 520 nm and was retained up to 4 ps. Then, the formation of a red-shifted intermediate with a broad absorption spectrum was observed from 20 ps to 1 ns. Another red-shifted intermediate with a narrow absorption spectrum was formed after 2 ns and was stable for at least 5 ns. The latter is therefore believed to correspond to I1 (PYP(L)), which has been detected on a nanosecond time scale or trapped at -80 degrees C. Singular value decomposition analysis demonstrated that the spectral shifts observed from 0.5 ps to 5 ns could be explained by two-component decay of excited state(s) and conversion from PYP(B) to PYP(L). The amount of PYP(L) at 5 ns was less than that of photoconverted PYP, suggesting the formation of another intermediate, PYP(H). In addition, the absorption spectra of these intermediates were calculated based on the proposed reaction scheme. Together, these results indicate that the photocycle of PYP at room temperature has a branched pathway in the early stage and is essentially similar to that observed under low-temperature spectroscopy.

Bacterial Proteins↗
PubMed2001

Effect of pedological characteristics on aqueous soil extraction recovery and tert-butyldimethylsilylation yield for gas chromatography-mass spectrometry of nerve gas hydrolysis products from soils.

Detection and identification of alkyl methylphosphonate (RMPA) and methylphosphonate (MPA) are performed to verify the existence of nerve gases by gas chromatography-mass spectrometry (GC-MS) after tert-butyldimethylsilylation (TBDMS). However, it is sometimes difficult to detect RMPA and MPA in soils. This study examines the relationship between the pedological characteristics and the aqueous extraction recoveries and TBDMS derivatization yields of ethyl-, isopropyl- and pinacolyl methylphosphonate and MPA for 21 soil samples. The aqueous extraction recoveries were measured directly by capillary electrophoresis. Andosols showed low extraction recoveries, while Regosols and Fluvisols showed high recoveries. RMPA were extracted with higher recoveries than MPA from all soils. MPA could not be extracted from Andosols. Within the pedological characteristics, phosphate absorption coefficients showed a strong negative correlation with the extraction recoveries of all phosphonates. The levels of RMPA and MPA in aqueous soil extracts were also determined for eight soils by GC-MS after TBDMS. Compared to the aqueous extraction recoveries, the yields of TBDMS derivatives were low. Strong anion exchange led to a significant improvement in derivatization yields. The efficiencies of TBDMS derivatization were inversely correlated with the levels of alkaline earth metals extractable from soils when the three soils that possessed high total carbon were excluded.

Chemical Warfare Agents↗
PubMed2001

Roles of amino acid residues near the chromophore of photoactive yellow protein.

To investigate the roles of amino acid residues around the chromophore in photoactive yellow protein (PYP), new mutants, Y42A, E46A, and T50A were prepared. Their spectroscopic properties were compared with those of wild-type, Y42F, E46Q, T50V, R52Q, and E46Q/T50V, which were previously prepared and specified. The absorption maxima of Y42A, E46A, and T50A were observed at 438, 469, and 454 nm, respectively. The results of pH titration for the chromophore demonstrated that the chromophore of PYP mutant, like the wild-type, was protonated and bleached under acidic conditions. The red-shifts of the absorption maxima in mutants tended toward a pK(a) increase. Mutation at Glu46 induced remarkable shifts in the absorption maxima and pK(a). The extinction coefficients were increased in proportion to the absorption maxima, whereas the oscillator strengths were constant. PYP mutants that conserved Tyr42 were in the pH-dependent equilibrium between two states (yellow and colorless forms). However, Y42A and Y42F were in the pH-independent equilibrium between additional intermediate state(s) at around neutral pH, in which yellow form was dominant in Y42F whereas the other was dominant in Y42A. These findings suggest that Tyr42 acts as the hinge of the protein, and the bulk as well as the hydroxyl group of Tyr42 controls the protein conformation. In all mutants, absorbance at 450 nm was decreased upon flash irradiation and afterwards recovered on a millisecond time scale. However, absorbance at 340--370 nm was increased vice versa, indicating that the long-lived near-UV intermediates are formed from mutants, as in the case of wild-type. The lifetime changes with mutation suggest the regulation of proton movement through a hydrogen-bonding network.

Amino Acids↗
PubMed2001

The complete nucleotide sequence of a plant root-inducing (Ri) plasmid indicates its chimeric structure and evolutionary relationship between tumor-inducing (Ti) and symbiotic (Sym) plasmids in Rhizobiaceae.

The Ri (root-inducing) plasmid in Agrobacterium rhizogenes and Ti (tumor-inducing) plasmid in Agrobacterium tumefaciens have provided the fundamental basis for the construction of plant vectors and transgenic plants. Recently, the determination of the first complete nucleotide sequence of the Ti plasmid (pTi-SAKURA) has been successful. To understand the general structure of these oncogenic T-DNA transfer plasmids, the whole nucleotide sequence of a mikimopine-type Ri plasmid, pRi1724, was analyzed. The plasmid is 217,594 bp in size, and has 173 open reading frames (ORFs) in total, which are asymmetrically distributed. Except for 27 ORFs, which are unknown, 173 ORFs were classified into 12 groups as follows: three for DNA replication, nine for plasmid modification, 22 for conjugation, 26 for virulence, 11 for T-DNA gene, 19 for mikimopine/mikimopine-lactam transport, ten for an unknown opine metabolism, seven for transcriptional regulator, five for sugar transport, five for glycerol metabolism, four for chemoreceptor and 32 for others. The elucidated chimeric structure of pRi1724 interestingly indicates that the evolution of Rhizobiaceae plasmids seems to have kept interactions among the plasmids; especially, the genes and elements for a conjugal transfer of pRi1724 had clearly closer kinship to those of a Sym (symbiotic) plasmid, pNGR234a in Rhizobium sp. than those of Ti plasmids. By using sequencing and Northern analysis, we examined the metabolic pathway and gene expression of mikimopine, which is probably an Ri-specific opine.

ATP-Binding Cassette Transporters↗
PubMed2001

Light induces destabilization of photoactive yellow protein.

To understand the effect of visible light on the stability of photoactive yellow protein (PYP), urea denaturation experiments were performed with PYP in the dark and with PYP(M) under continuous illumination. The urea concentrations at the midpoint of denaturation were 5.26 +/- 0.29 and 3.77 +/- 0.19 M for PYP and PYP(M), respectively, in 100 mM acetate buffer, and 5.26 +/- 0.24 and 4.11 +/- 0.12 M for PYP and PYP(M), respectively, in 100 mM citrate buffer. The free energy change upon denaturation (DeltaG(D)(H2O)), obtained from the denaturation curve, was 11.0 +/- 0.4 and 7.6 +/- 0.2 kcal/mol for PYP and PYP(M), respectively, in acetate buffer, and 11.5 +/- 0.3 and 7.8 +/- 0.1 kcal/mol for PYP and PYP(M), respectively, in citrate buffer. Even though the DeltaG(D)(H2O) value for PYP(M) is almost identical in the two buffer systems, the urea concentration at the midpoint of denaturation is lower in acetate buffer than in citrate buffer. Although their CD spectra indicate that the protein conformations of the denatured states of PYP and PYP(M) are indistinguishable, the configurations of the chromophores in their denatured structures are not necessarily identical. Both denatured states are interconvertible through PYP and PYP(M). Therefore, the free energy difference between PYP and PYP(M) is 3.4-3.7 kcal/mol for the protein moiety, plus the additional contribution from the difference in configuration of the chromophore.

Acetates↗
PubMed2001

Solution structure of Grb2 reveals extensive flexibility necessary for target recognition.

Grb2 is an adaptor protein composed of a single SH2 domain flanked by two SH3 domains. Grb2 functions as an important evolutionary conserved link between a variety of cell membrane receptors and the Ras/MAP kinase-signaling cascade. Here, we describe the solution structure of Grb2 as revealed by NMR and small angle X-ray scattering measurements. We demonstrate that Grb2 is a flexible protein in which the C-terminal SH3 domain is connected to the SH2 domain via a flexible linker. This is in contrast to the previously described Grb2 crystal structure, which showed a compact structure with intramolecular contact between two SH3 domains. Binding experiments on Grb2 and peptides containing two different proline-rich sequences indicate that Grb2 adapts the relative position and orientation of the two SH3 domains to bind bivalently to the target peptide sequences.

Adaptor Proteins, Signal Transducing↗
PubMed2001

Interfering effect of diphtheria-tetanus-acellular pertussis combined (DTaP) vaccines on the bacterial endotoxin test.

We evaluated applicability of the endotoxin test to DTaP vaccines. Although no DTaP vaccine batches showed immediate interference with the activating activity of spiked endotoxin on the clotting of Limulus amaebocyte lysate (LAL), a gradually progressing interference depending on the time after spiking was seen for some of the batches. The interfering DTaP vaccine batches, however, showed no significant effect onin vitro TNF-alpha induction in RAW264.7 cells and pyrogenicity in rabbits of spiked endotoxin. Aluminium hydroxide gel in the vaccines was suggested to be one of the causes of the interference. Accordingly, a careful evaluation of the interfering effect was assumed crucial for the effective application of the endotoxin test to check residual biological activity of endotoxin in DTaP vaccines.

Animals↗
PubMed2001

Synthesis of optically pure ethyl (S)-4-chloro-3-hydroxybutanoate by Escherichia coli transformant cells coexpressing the carbonyl reductase and glucose dehydrogenase genes.

The asymmetric reduction of ethyl 4-chloro-3-oxobutanoate (COBE) to ethyl (S)-4-chloro-3-hydroxybutanoate ((S)-CHBE) was investigated. Escherichia coli cells expressing both the carbonyl reductase (S1) gene from Candida magnoliae and the glucose dehydrogenase (GDH) gene from Bacillus megaterium were used as the catalyst. In an organic-solvent-water two-phase system, (S)-CHBE formed in the organic phase amounted to 2.58 M (430 g/l), the molar yield being 85%. E. coli transformant cells coproducing S1 and GDH accumulated 1.25 M (208 g/l) (S)-CHBE in an aqueous monophase system by continuously feeding on COBE, which is unstable in an aqueous solution. In this case, the calculated turnover of NADP+ (the oxidized form of nicotinamide adenine dinucleotide phosphate) to CHBE was 21,600 mol/mol. The optical purity of the (S)-CHBE formed was 100% enantiomeric excess in both systems. The aqueous system used for the reduction reaction involving E. coli HB101 cells carrying a plasmid containing the S1 and GDH genes as a catalyst is simple. Furthermore, the system does not require the addition of commercially available GDH or an organic solvent. Therefore this system is highly advantageous for the practical synthesis of optically pure (S)-CHBE.

Acetoacetates↗
PubMed2001

Extreme discrepancy between macroscopic diagnosis and pathological findings of gallbladder cancer treated by hepatopancreatoduodenectomy.

Diagnosis of gallbladder cancer in terms of invasion depth and spread is an important factor in determining cumulative survival after surgical treatment. However, diagnostic methods available at present occasionally fail to judge staging correctly. We report a case of gallbladder cancer which showed extreme discrepancy between the preoperative macroscopic and imaging diagnosis (positive direct invasion to the liver and invasion to the bile duct and duodenum through the serosal layer; S3, Hinf3, Binf2, and stage IV by the Japanese Society of Biliary Surgery classification) and the pathological findings (limited in vasion within the subserosal layer; ss, hinf0. binf0, and stage II). This discrepancy allowed us to perform curative treatment by hepatopancreatoduodenectomy, including extended right lobectomy of the liver, external bile duct resection, resection of the mesocolon, and lymph node dissection. Surgeons should aim for curability of advanced gallbladder cancer by radical resection until accurate methods for the preoperative diagnosis of cancer spread are available, because the clinical picture may be modified by inflammatory changes.

Cholangiopancreatography, Endoscopic Retrograde↗
PubMed2001

Antibacterial action of tryptanthrin and kaempferol, isolated from the indigo plant (Polygonum tinctorium Lour.), against Helicobacter pylori-infected Mongolian gerbils.

We evaluated the effect of tryptanthrin and kaempferol, both isolated from Polygonum tinctorium Lour., against Helicobacter pylori colony formation in vitro and in H. pylori-infected Mongolian gerbils. H. pylori suspension was mixed with solution of tryptanthrin and/or kaempferol and placed onto agar plates. These plates were incubated at 37 degrees C, under 10% CO2 for 5 days, and the H. pylori colonies were counted. For the in vivo experiment, Mongolian gerbils were inoculated with H. pylori ATCC 43504 orally. After 4 weeks, the infected gerbils were given tryptanthrin and/or kaempferol, administered orally, twice a day for 10 days. The animals were killed and the number of live H. pylori in their stomachs was determined. In vitro both tryptanthrin and kaempferol significantly decreased the numbers of H. pylori colonies a dose-dependent manner. An additive effect on colony formation was observed with the combined use. In the in vivo experiment, oral administration of tryptanthrin and/or kaempferol significantly decreased the numbers of colonies in the gerbils' stomachs. We concluded that tryptanthrin and kaempferol were effective against H. pylori in vivo.

Animals↗