Search PubMed⌕ Search

Biomedical subjects

M J Waring

Publications and source records attributed to M J Waring.

171 records · Page 10Linked to original sources
PubMedDate not supplied

The influence of the exocyclic amino group characteristic of GC base pairs on molecular recognition of specific nucleotide sequences in DNA by berenil and DAPI.

The expedient of preparing homologous DNA samples substituted with inosine for guanosine residues, 2,6-diaminopurine (DAP) for adenine residues, or both, has been used to investigate the role of the purine 2-amino group in determining the preferred binding sites for the drugs berenil [1,3-bis(4-phenylamidinium) triazene] and DAPI (4',6-diamidino-2-phenyl indole) on DNA. The selectivity of these two minor groove binders for AT-rich sequences is seen to be radically altered in the substituted DNA molecules. Neither berenil nor DAPI bind to DAP-substituted DNA where all purine residues bear a 2-amino group. By contrast, they bind to AT-rich, IC-rich and even mixed sequences of the inosine DNA where all purine residues lack the 2-amino group. With the inosine and DAP double substituted DNA, both berenil and DAPI bind preferentially to IC-rich clusters instead of their canonical tracts endowed with an extra 2-amino group through substitution with DAP. These results establish that the location of the purine 2-amino group represents a critical determinant for recognition of DNA nucleotide sequences by the two drugs.

2-Aminopurine↗
PubMedDate not supplied

Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

Cisplatin↗
PubMedDate not supplied

Sequence-specific DNA cleavage by dipeptides disubstituted with chlorambucil and 2,6-dimethoxyhydroquinone-3-mercaptoacetic acid.

Two dipeptides, each containing a lysyl residue, were disubstituted with chlorambucil (CLB) and 2,6-dimethoxyhydroquinone-3-mercaptoacetic acid (DMQ-MA): DMQ-MA-Lys(CLB)-Gly-NH2 (DM-KCG) and DMQ-MA-beta-Ala-Lys(CLB)-NH2 (DM-BKC). These peptide-drug conjugates were designed to investigate sequence-specificity of DNA cleavage directed by the proximity effect of the DNA cleavage chromophore (DMQ-MA) situated close to the alkylating agent (CLB) inside a dipeptide moiety. Agarose electrophoresis studies showed that DM-KCG and DM-BKC possess significant DNA nicking activity toward supercoiled DNA whereas CLB and its dipeptide conjugate Boc-Lys(CLB)-Gly-NH2 display little DNA nicking activity. ESR studies of DMQ-MA and DM-KCG both showed five hyperfine signals centered at g = 2.0052 and are assigned to four radical forms at equilibrium, which may give rise to a semiquinone radical responsible for DNA cleavage. Thermal cleavage studies at 90 degrees C on a 265-mer test DNA fragment showed that besides alkylation and cleavage at G residues, reactions with DM-KCG and DM-BKC show a preference for A residues with the sequence pattern: 5'-G-(A)n-Pur-3' > 5'-Pyr-(A)n-Pyr-3' (where n = 2-4). By contrast, DNA alkylation and cleavage by CLB occurs at most G and A residues with less sequence selectivity than seen with DM-KCG and DM-BKC. Thermal cleavage studies using N7-deazaG and N7-deazaA-substituted DNA showed that strong alkylation and cleavage at A residues by DM-KCG and DM-BKC is usually flanked on the 3' side by a G residue whereas strong cleavage at G residues is flanked by at least one purine residue on either the 5' or 3' side. At 65 degrees C, it is notable that the preferred DNA cleavage by DM-KCG and DM-BKC at A residues is significantly more marked than for G residues in the 265-mer DNA; the strongest sites of A-specific reaction occur within the sequences 5'-Pyr-(A)n-Pyr-3'; 5'-Pur-(A)n-G-3' and 5'-Pyr-(A)n-G-3'. In pG4 DNA, cleavage by DM-KCG and DM-BKC is much greater than that by CLB at room temperature and at 65 degrees C. It was also observed that DM-KCG and DM-BKC cleaved at certain pyrimidine residues: C40, T66, C32, T34, and C36. These cleavages were also sequence selective since the susceptible pyrimidine residues were flanked by two purine residues on both the 5' and 3' sides or by a guanine residue on the 5' side. These findings strongly support the proposal that once the drug molecule is positioned so as to permit alkylation by the CLB moiety, the DMQ-MA moiety is held close to the alkylation site, resulting in markedly enhanced sequence-specific cleavage.

Antineoplastic Agents↗
PubMedDate not supplied

Antitumor combilexin. A thiazole-containing analogue of netropsin linked to an acridine chromophore.

We report the synthesis, DNA-binding properties and antitumor activity of ThiaNetGA, a hybrid molecule in which are conjugated a thiazole-lexitropsin and an intercalating anilinoacridine chromophore. This combilexin molecule binds to DNA via a bimodal process involving minor groove binding of the lexitropsin moiety and intercalation of the acridine moiety. The uptake and distribution of the hybrid in L1210 leukemia cells were investigated by ESR spectroscopy using a spin-labeled derivative. The nitroxide-containing conjugate accumulates preferentially in the cell nuclei and rapidly saturates the nuclear receptor sites. Both in vitro and in vivo assays indicate that the drug is practically nontoxic but exhibits moderate antitumor activity against P388 leukemia cells in mice.

Acridines↗