Search PubMed⌕ Search

Biomedical subjects

M Hirose

Publications and source records attributed to M Hirose.

At least 55 records · Page 3Linked to original sources
PubMed2002

Inhibition of proliferation of gastric epithelial cells by a cyclooxygenase 2 inhibitor, JTE522, is also mediated by a PGE2-independent pathway.

BACKGROUND: Cyclooxygenase-2 (COX-2) is one of the rate-limiting enzymes for prostaglandin synthesis from arachidonic acid. Although it is known that inhibition of cyclooxygenase activity delays ulcer healing, the regulatory relationship between COX-2 and its metabolites in gastric epithelial cell proliferation is not well known. AIM: To investigate whether COX-2 has an effect on gastric mucosal cell proliferation and further studied whether such effect is mediated only by prostaglandin E2 (PGE2), a representative metabolite of arachidonates in the gastric mucosa. METHODS: Artificial wounds of defined area size were created on complete monolayer cell sheets of isolated rat gastric epithelial cells and rat gastric cell line RGM1 under the addition of arachidonic acid or a COX-2 selective inhibitor, JTE522. Repair of wounds was assessed by monitoring wound size, with cell proliferation detected using 5-bromodeoxyuridine staining. Quantity of secreted PGE2 was measured by enzyme immunoassay. RESULTS: Stimulation of foetal calf serum increased the expression of COX-2 protein and inhibition of COX-2 retarded wound healing with reduction of cell proliferation. Arachidonic acid increased PGE2 production and accelerated restoration. Combination of JTE522 and arachidonic acid resulted in a marked retardation of wound healing compared to the control, but JTE522 did not completely suppress the increase in cellular PGE2 content following the addition of arachidonate. CONCLUSIONS: The difference in the effects of JTE522 on PGE2 production and on wound healing suggest that the involvement of COX-2 in gastric epithelial cell proliferation is not mediated solely by PGE2.

Animals↗
PubMed2002

Preoperative risk factors of intraoperative hypothermia in major surgery under general anesthesia.

UNLABELLED: Preoperative factors, such as age and body habitus, affect intraoperative hypothermia during general anesthesia. In a preliminary study, we developed a logistic model to retrospectively evaluate predictors of intraoperative hypothermia in patients who received major surgery. The following factors were selected to develop the model: Z = -15.014 + 0.097 x (Age) + 0.263 x (Height) - 0.323 x (Weight) - 0.055 x (Preoperative systolic blood pressure) - 0.121 x (Preoperative heart rate). By using this model, the probability of hypothermia can be estimated by applying the following formula: Probability = 1/(1 + e(-)(Z)). If an estimated probability of hypothermia was >0.5, the sensibility of prediction was 81.5% and the specificity was 83%. In the second study, the model was applied prospectively to other patients, and the validity of the logistic model was evaluated. The core temperature showed a significant decrease in patients with a probability >0.7, who were predicted to be hypothermic, and their thermoregulatory vasoconstriction threshold also showed a significant decrease, compared with the patients with a probability <==0.3, who were predicted to be normothermic. We concluded that intraoperative hypothermia could be predicted from preoperative characteristics such as age, height, weight, systolic blood pressure, and heart rate. IMPLICATIONS: Increases in age and height and decreases in weight systolic blood pressure and heart rate are major preoperative risk factors of intraoperative hypothermia during major surgery.

Aged↗
PubMed2002

Spontaneous development of aberrant crypt foci in F344 rats.

Aberrant crypt foci (ACF) have been proposed as intermediate biomarkers for colon carcinogenesis on the basis of many rodent studies. Although molecular analyses have indicated that these lesions in experimental animals are related to early events in colon carcinogenesis, their preneoplastic nature has yet to be fully elucidated. In the present study, one hundred and thirty 19-week-old male Fischer 344 rats were examined. The biological characteristics of spontaneous ACF were analyzed histopathologically, immunohistochemically and with molecular biological techniques, and compared with colon tumors found in control groups used for carcinogenicity tests. The incidences of spontaneous ACF consisting of 1, 2, 3 and 4 or more crypts were respectively 27.7%, 32.5%, 16.8% and 22.8%. Most ACF were distributed in the lower middle and upper distal colon, and proximal colon ACF was rare. Likewise, ACF frequently (42.5%) developed in untreated animals, whereas the incidence of spontaneous colorectal tumors was extremely low (0.68%) in control male rats. In addition, spontaneous ACF did not show apparent proliferative activity or c-K-ras point mutations. Our results thus suggest that spontaneous ACF rarely progress to colon tumors although long-term sequential observation might be necessary to conclude the significance of ACF.

Adenocarcinoma↗
PubMed2001

Altered psychomotor behaviors in mice lacking pituitary adenylate cyclase-activating polypeptide (PACAP).

Pituitary adenylate cyclase-activating polypeptide (PACAP) has been conserved remarkably during evolution and is widely expressed in the mammalian brain. In Drosophila, mutation of the PACAP homologue results in behavioral defects, including impaired olfaction-associated learning and changes in ethanol sensitivity. Here, we report the generation of mice lacking the PACAP gene (PACAP(-/-)). PACAP(-/-) mice were born in the expected Mendelian ratios but had a high early-mortality rate. The surviving adult PACAP(-/-) mice displayed remarkable behavioral changes; they exhibited hyperactive and explosive jumping behaviors in an open field, increased exploratory behavior, and less anxiety in the elevated plus maze, emergence, and novel-object tests. Analysis of PACAP(-/-) mice brains revealed that the serotonin metabolite 5-hydroxyindoleacetic acid was slightly decreased in the cortex and striatum compared with wild-type mice. The present study provides evidence that PACAP plays a previously uncharacterized role in the regulation of psychomotor behaviors.

Animals↗
PubMed2001

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method.

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).

DNA↗
PubMed2001

Involvement of p38 MAP kinase pathway in the synergistic activation of PACAP mRNA expression by NGF and PACAP in PC12h cells.

We have recently shown that in PC12 cells, PACAP and NGF synergistically increase PACAP gene transcription and mRNA level, and that the MAPK/ERK kinase inhibitor PD98059 blocks the PACAP mRNA expression induced by either PACAP or NGF, but not that induced by the combination, suggesting involvement of multiple signaling pathways. Here we show that the p38 MAPK inhibitor SB203580 almost completely inhibits the PACAP mRNA expression induced by PACAP alone or in combination with NGF. PACAP induces neurite outgrowth and potentiates NGF-induced neurite outgrowth in PC12h cells. Unlike the case for the PACAP mRNA expression, SB203580 did not affect, but PD98059 reduced, PACAP and NGF-induced neurite outgrowth. These results indicate that PACAP receptors are coupled to the p38 signaling pathway, and that p38 plays a key role in the regulation of PACAP gene expression, while ERK, but not p38, MAPK is involved in PACAP and NGF-induced neurite outgrowth.

Animals↗
PubMed2001

Anion-mediated Fe3+ release mechanism in ovotransferrin C-lobe: a structurally identified SO4(2-) binding site and its implications for the kinetic pathway.

The differential properties of anion-mediated Fe(3+) release between the N- and C-lobes of transferrins have been a focus in transferrin biochemistry. The structural and kinetic characteristics for isolated lobe have, however, been documented with the N-lobe only. Here we demonstrate for the first time the quantitative Fe(3+) release kinetics and the anion-binding structure for the isolated C-lobe of ovotransferrin. In the presence of pyrophosphate, sulfate, and nitrilotriacetate anions, the C-lobe released Fe(3+) with a decelerated rate in a single exponential progress curve, and the observed first order rate constants displayed a hyperbolic profile as a function of the anion concentration. The profile was consistent with a newly derived single-pathway Fe(3+) release model in which the holo form is converted depending on the anion concentration into a "mixed ligand" intermediate that releases Fe(3+). The apo C-lobe was crystallized in ammonium sulfate solution, and the structure determined at 2.3 A resolution demonstrated the existence of a single bound SO(4)(2-) in the interdomain cleft, which interacts directly with Thr(461)-OG1, Tyr(431)-OH, and His(592)-NE2 and indirectly with Tyr(524)-OH. The latter three groups are Fe(3+)-coordinating ligands, strongly suggesting the facilitated Fe(3+) release upon the anion occupation at this site. The SO(4)(2-) binding structure supported the single-pathway kinetic model.

Anions↗
PubMed2001

Site-dependent modulating effects of conjugated fatty acids from safflower oil in a rat two-stage carcinogenesis model in female Sprague-Dawley rats.

Modifying effects of dietary administration of conjugated fatty acids from safflower oil (CFA-S), rich in conjugated linoleic acid, on major organs were examined in the post-initiation stage of a two-stage carcinogenesis model in female rats. Groups of 21 or 22 F344 female rats were treated sequentially with 2,2'-dihydroxy-di-n-propylnitosamine (intragastrically, i.g.), 7,12-dimethylbenz[a]anthracene (i.g.), 1,2-dimethylhydrazine (subcutaneously) and N-butyl-N-(4-hydroxybutyl)nitrosamine (in drinking water) during the first 3 weeks for initiation, and then administered diet containing 1 or 0.1% CFA-S for 33 weeks. Further groups of animals were treated with carcinogens or 1% CFA-S alone, or maintained as non-treated controls. All surviving animals were killed at week 36, and major organs were examined histopathologically for development of pre-neoplastic and neoplastic lesions. The 1 and 0.1% CFA-S treatment significantly decreased the incidence and multiplicity of mammary carcinomas, though a clear dose response was not observed. In the urinary bladder, the incidence of papillary or nodular hyperplasia but not tumors was significantly increased in the 1% CFA-S-treated group. The results indicate that low dose CFA-S may find application as a potent chemopreventor of mammary carcinogenesis.

1,2-Dimethylhydrazine↗
PubMed2001

Green tea catechins enhance tumor development in the colon without effects in the lung or thyroid after pretreatment with 1,2-Dimethylhydrazine or 2,2'-dihydroxy-di-n-propylnitrosamine in male F344 rats.

Modifying effects of green tea catechins (GTCs) on the post-initiation stage of colon, lung and thyroid carcinogenesis were examined in F344 male rats. Groups of 20 animals were given subcutaneous injections of 40 mg/kg body wt of 1,2-dimethylhydrazine twice a week for 2 weeks or oral administration of 0.1% 2,2'-dihydroxy-di-n-propylnitrosamine (DHPN) in the drinking water for 2 weeks for initiation. They then received diet containing 1 or 0.1% green tea catechin or basal diet alone for 33 weeks. Histopathological examination after final sacrifice showed that although total incidence and multiplicity of colon tumors were not significantly different from controls, values for colon adenomas were decreased while those for carcinomas and the average size of tumors were significantly increased in the 0.1% GTC group. A similar tendency was observed for the 1% GTC group. Incidences and/or multiplicity of lung hyperplasia and tumors, and thyroid lesions did not significantly vary among the DHPN-treated groups. These results indicate that GTCs do not inhibit, but rather may enhance colon carcinogenesis, while not influencing lung and thyroid carcinogenesis under the present experimental conditions.

1,2-Dimethylhydrazine↗
PubMed2001

Domain closure mechanism in transferrins: new viewpoints about the hinge structure and motion as deduced from high resolution crystal structures of ovotransferrin N-lobe.

The crystal structure of holo hen ovotransferrin N-lobe refined at 1.65 A resolution has been obtained. The final model gave an R-factor of 0.173 in the resolution range between 10.0 and 1.65 A. The comparison of the structure with previous high-resolution apo and Fe(3+)-loaded, domain-opened intermediate structures provides new viewpoints on the domain closure mechanism upon Fe(3+) uptake in ovotransferrin N-lobe. Overall, conformational transition follows the common mechanism that has been first demonstrated for lactoferrin N-lobe; the domains 1 and 2 rotate 49.7 degrees as rigid bodies with a translation of 2.1 A around a screw-axis that passes through the two interdomain beta-strands (89-94 and 244-249). It is generally believed that the two strands display a hinge-like motion. Here, the latter strand indeed displays an ideal hinge nature: the segments 244-246 and 248-249 behave as a part of the rigid body of domain 2 and that of domain 1, respectively, and a sharp bend upon the domain closure is largely accounted for by the changes in the torsion angles phi and psi of Val247. We find, however, that the mode of the conformational change in the first beta-strand is much more complex. Two of the five inter beta-strand hydrogen bonds undergo crucial exchanges: from Ser91-N...Val247-O and Thr89-O...Ala249-N in the open apo and intermediate structures into Tyr92-N...Val247-O and Thr90-O...Ala249-N in the closed holo structure. These exchanges, which may be triggered in the intermediate state by modulation in the topological relation between the Fe(3+)-ligated hinge residue Tyr92-OH and the anion anchor residues of helix 5, are accompanied by a large conformational change and extensive hydrogen bonding rearrangements in a long stretch of segment of Glu82 to Tyr92. Such structural transition would work as a driving force for the domain closure, which highlights a "door closer"-like role, in addition to the canonical-hinge role, for the interdomain polypeptide segment pair. As an alternative hinge that secures the correct domain motion by being placed on a significant distance from the beta-strand hinge, we point out the participation of the van der Waals contacts formed between domain 1 residue of Met331 and domain 2 residues of Trp125, Ile129 and Trp140.

Animals↗
PubMed2001

Cloning and rational mutagenesis of kexstatin I, a potent proteinaceous inhibitor of Kex2 proteinase.

Kexstatin I is a potent proteinaceous inhibitor of Kex2 proteinase (EC 3.4.21.61). In the present study we show the molecular cloning, primary structure determination and expression of the gene encoding kexstatin I. We also demonstrate its enhanced activity and specificity for Kex2 proteinase inhibition by rational mutagenesis. The cloned kexstatin I gene encoded a protein of 145 amino acid residues, including the 35-residue signal sequence for secretion. The amino acid sequence showed 52% identity with those of the Streptomyces subtilisin inhibitors (SSIs). Thus kexstatin I is the first SSI-family member that can inhibit Kex2 proteinase. The reactive site of the inhibitor was determined to be -Thr(69)-Lys(70) downward arrowGlu(71)-, where downward arrow indicates the reactive site. Because Kex2 proteinase generally shows the highest affinity for substrates with basic amino acid residues at the P(1) and P(2) sites, conversion of the Thr(69)-Lys(70) segment of the inhibitor into dibasic motifs was expected to result in enhanced inhibitory activities. Thus we constructed kexstatin I mutants, in which the Thr(69)-Lys(70) sequence was replaced by the Thr(69)-Arg(70), Lys(69)-Lys(70) and Lys(69)-Arg(70) sequences using PCR-based mutagenesis, and analysed them kinetically. Among these mutants, the Lys(69)-Arg(70) mutant was the most potent inhibitor. The K(i) for Kex2 proteinase was 3.2x10(-10) M, which was 140-fold lower than that of the inhibitor with the Thr(69)-Lys(70) sequence. Although kexstatin I could also inhibit subtilisin, the enhancement of inhibitory activity upon such mutations was specific for Kex2 proteinase inhibition.

Amino Acid Sequence↗
PubMed2001

Stoichiometry of subunit e in rat liver mitochondrial H(+)-ATP synthase and membrane topology of its putative Ca(2+)-dependent regulatory region.

Previous studies have revealed that residues 34-65 of subunit e of mitochondrial H(+)-ATP synthase are homologous with the Ca(2+)-dependent tropomysin-binding region for troponin T and have suggested that subunit e could be involved in the Ca(2+)-dependent regulation of H(+)-ATP synthase activity. In this study, we determined the content of subunit e in H(+)-ATP synthase purified from rat liver mitochondria, and we also investigated the membrane topology of a putative Ca(2+)-dependent regulatory region of subunit e using an antibody against peptide corresponding to residues 34-65 of subunit e. Quantitative immunoblot analysis of subunit e in the purified H(+)-ATP synthase revealed that 1 mol of H(+)-ATP synthase contained 2 mol of subunit e. The ATPase activity of mitoplasts, in which the C-side of F(0) is present on the outer surface of the inner membrane, was significantly stimulated by the addition of the antibody, while the ATPase activity of submitochondrial particles and purified H(+)-ATP synthase was not stimulated. The antibody bound to mitoplasts but not to submitochondrial particles. These results suggest that the putative Ca(2+)-dependent regulatory region of subunit e is exposed on the surface of the C-side of F(0) and that subunit e is involved in the regulation of mitochondrial H(+)-ATP synthase activity probably via its putative Ca(2+)-dependent regulatory region.

Animals↗
PubMed2001

Measurement of the CP violation parameter sin2 phi(1) in B(0)(d) meson decays.

We present a measurement of the standard model CP violation parameter sin2 phi(1) (also known as sin2beta) based on a 10.5 fb(-1) data sample collected at the Upsilon(4S) resonance with the Belle detector at the KEKB asymmetric e(+)e(-) collider. One neutral B meson is reconstructed in the J/psiK(S), psi(2S)K(S), chi(c1)K(S), eta(c)K(S), J/psiK(L), or J/psipi(0) CP-eigenstate decay channel and the flavor of the accompanying B meson is identified from its charged particle decay products. From the asymmetry in the distribution of the time interval between the two B-meson decay points, we determine sin2 phi(1) = 0.58(+0.32)(-0.34)(stat)+0.09-0.10(syst).

Journal Article↗
PubMed2001

Novel patterned cell coculture utilizing thermally responsive grafted polymer surfaces.

Here we demonstrate a novel cell coculture method without any apparent limitation in cell-type combinations that exploits thermally responsive polymer-grafted patterns to alter cell-cell and cell-surface interactions. Thermally responsive acrylamide polymer is first covalently patterned onto culture surfaces by masked electron beam irradiation. One cell type is then cultured to confluency at 37 degrees C. Reducing cell culture temperature below 32 degrees C selectively swells temperature sensitive polymer-grafted domains, detaching adherent cells only from these grafted patterns. Another cell type is then seeded over the same surface at 37 degrees C. These subsequently seeded cells adhere only to the now-exposed polymer-grafted domains. Initially seeded cells remaining adherent on nonpatterned surfaces and cells added in the second seeding are then cocultured at 37 degrees C in well-ordered patterns.

Acrylic Resins↗
PubMed2001

Expression and characterization of recombinant human antithrombin III in Pichia pastoris.

Antithrombin III (ATIII) is a member of the serpin superfamily and a major regulator of the blood coagulation cascade. To express recombinant human ATIII (rATIII) in the methylotrophic yeast Pichia pastoris, we constructed an rATIII expression plasmid which contained the ATIII cDNA encoding mature protein region connected with the truncated mAOX2 promoter and the SUC2 secretion signal, introduced it into the P. pastoris genome, and screened for a single copy transformant. The secretion of rATIII from the transformant reached a level of 320 IU/L in the culture broth at 169 h. From the culture-supernatant, rATIII was purified to over 99% by heparin-affinity chromatography and other column chromatography methods. We characterized rATIII and compared it with human plasma-derived ATIII (pATIII). The purified rATIII possessed correct N-terminal amino acid sequence, and its molecular weight by SDS-PAGE of 56,000 Da was slightly different from the 58,000 Da of pATIII. Sequence and mass spectrometry analysis of BrCN fragments revealed that posttranslational modifications had occurred in rATIII. O-linked mannosylation was found at Ser 3 and Thr 9, and in some rATIII molecules, modification with O-linked mannosyl-mannose had probably occurred at Thr 386, close to the reactive center. Although the heparin-binding affinity of rATIII was 10-fold higher than that of pATIII, its inhibitory activity against thrombin was only half. As the conformation of rATIII and pATIII by circular dichroism spectroscopy was similar, O-glycosylation in the reactive center loop was assumed to be mainly responsible for the decreased inhibitory activity. pATIII can inactivate thrombin through formation of a stable thrombin-ATIII complex, but rATIII modified with O-glycosylation in the reactive center loop may act as a substrate rather than an inhibitor of thrombin.

Antithrombin III↗
PubMed2001

Testicular toxicity of nitrofurazone causing germ cell apoptosis in rats.

In order to clarify the mechanism underlying testicular toxicity of nitrofurazone (NF), two experiments were performed. In experiment 1, sequential histopathological examination of testes after a single oral administration of 100 or 300 mg/kg NF to male rats demonstrated that degeneration of pachytene spermatocytes with an eosinophilic, shrunken appearance in stages VII-VIII and vacuolation of Sertoli cells were first observed 12 h after treatment. By 24 h, degeneration of pachytene spermatocytes in stages VII-XII and diplotene spermatocytes were observed. On post-treatment day 4, neither spermatocytes nor spermatids located inside the pachytene spermatocytes in stage VII were seen anywhere. Generation of seminiferous epithelium progressed with recovery to almost normal morphology after 12 weeks, although some morphological changes were still present. No lesions were apparent in spermatogonia, preleptotene spermatocytes, leptotene spermatocytes, zygotene spermatocytes or Leydig cells. Degenerate pachytene spermatocytes and some round spermatids seen after 24 h showed positive TdT-mediated dUTP-biotin nick end labeling (TUNEL). In addition, DNA laddering patterns were detected with agarose gel electrophoresis, and increased electron density of nuclei and cytoplasm of degenerating spermatocytes with nuclear chromatin focal aggregations were observed by electron microscopy, indicating that cell death was attributable to apoptosis. In experiment 2, sequential serum sex-related hormone levels were assayed after a single oral administration of 300 mg/kg NF to male rats and revealed a significant increase of testosterone and a decrease of progesterone at 6 h, and decreases of luteinizing hormone at 12 h and testosterone at 24 h. Prolactin tended to decrease from 12 h after treatment and the decrease was significant at 48 h. No significant changes were observed in levels of follicle-stimulating hormone or estradiol. The probability that NF damages germ cells by causing a hormonal imbalance is extremely low, since no pattern of hormonal imbalance that could be regarded as the cause of the testicular degeneration was observed until 12 h after NF treatment when pachytene spermatocytes began to degenerate. The present experiments suggest that NF damages Sertoli cells and pachytene spermatocytes in stages VII-XII directly.

Administration, Oral↗
PubMed2001

A repeated 28-day oral dose toxicity study of methoxychlor in rats, based on the 'enhanced OECD test guideline 407' for screening endocrine-disrupting chemicals.

In association with the international validation project to establish an OECD Enhanced Test Guideline 407, we performed a 28-day repeated-dose toxicity study of methoxychlor, a chlorinated hydrocarbon pesticide with pro-estrogenic and anti-androgenic activities. Attention was paid to the sensitivity of certain additional parameters for detecting endocrine related effects of endocrine disrupting chemicals based on the existing TG 407. Seven-week-old Crj:CD(SD)IGS rats were allocated to one of four groups, each consisting often males and ten females, and methoxychlor was administered once daily by gavage at doses of 0 (control), 20, 100 or 500 mg/kg body weight per day. Male rats were killed on the day after the 28th administration. Female rats were killed on the day of the diestrus stage during 4 days after the 28th administration. Male rats receiving methoxychlor showed mainly atrophy of mammary acinus in the 20 mg/ kg and higher groups, together with decreases in prostate and seminal vesicle weights, and atrophy of epididymis, prostate, seminal vesicle and coagulating gland in the 100 and 500 mg/kg groups. In addition, decrease in serum testosterone level, increase in follicle-stimulating hormone level, decrease in testis and epididymis weights, atrophy of semiferous tubules and Leydig cells, decrease in the number of sperm in the caudal epididymis and their motility were observed in the 500 mg/kg group. Female rats receiving methoxychlor showed mainly abnormal estrous cycles, decrease in serum luteinizing hormone level, decrease in ovary weight, proliferation of mammary acinus, atrophy of ovary due to decrease in follicles and corpus luteum in histopathology, hypertrophy of endometrial epithelium of uterus and vagina epithelium in the 100 and 500 mg/kg groups. Among the parameters tested in the present experimental system, effects of methoxychlor on endocrine-related organs were detected with regard to serum hormone, organ weights, histopathological examination in both sexes, estrus cycle in females and sperm examination in males. Based on these results, a no-observed-adverse-effect level (NOAEL) in the present study was estimated to be below 20 mg/kg per day. In particular, the adverse effects were effectively detected in organ weights of accessory sex organs and histopathological examination.

Administration, Oral↗