Search PubMed⌕ Search

Biomedical subjects

M Hirose

Publications and source records attributed to M Hirose.

At least 19 recordsLinked to original sources
PubMed2003

In-situ visualization and quantification of mineralization of cultured osteogenetic cells.

An osteoblastic cell line (HOS cells) produces a prominent osteoid matrix with mineralization. Fibroblasts, on the other hand, do not exhibit this mineralization. To evaluate the degree of mineralization, we added calcein to the culture medium and then observed the culture wells by using an image analyzer. The calcein uptake into the cell/matrix layer was detected in the HOS cells but not in the fibroblasts. The calcein uptake was also quantified in situ by using an image analyzer, which revealed high levels in the HOS cells, which correlated well with the calcium content of the mineralized matrix. Rat marrow cells were also cultured in media containing calcein, fetal bovine serum, beta-glycerophosphate, L-ascorbic acid 2-phosphate, and with or without dexamethasone. With the dexamethasone, the cells exhibited osteogenic differentiation that resulted in mineralized matrix formation after about 10 days. The matrix formation coincided with the appearance of calcein uptake into the cell/matrix layer, with the amount of calcein uptake increasing with time. By contrast, the culture without the dexamethasone did not exhibit matrix formation and the calcein uptake was negligible. In the case of both HOS cell and rat marrow cell cultures in vitro, calcein did not affect expressions of their alkaline phosphatase activity or osteocalcin production. Furthermore, histologic observation revealed that rat marrow cells subcultured with calcein could show osteogenic ability after in vivo implantation. These results suggest that the current method of detecting calcein uptake in a culture allows the monitoring of the osteogenic capacity of cultured cells, as well as the measurement of the amount of mineralization produced by the osteogenic cells. Given that osteogenic cultured cells/mineralized matrices are used in bone reconstruction surgery, the in situ monitoring method is invaluable in that it allows us to evaluate the osteogenic capacity of in vitro constructs.

Alkaline Phosphatase↗
PubMed2003

A subchronic toxicity study of shea nut color in Wistar rats.

Shea nut color, obtained from nuts of the shea tree (Butyrospermum parkii), is used as a food-coloring agent. Flavonoid pigments are considered to be the responsible constituents. As there have been no reports of toxicological evaluation, a 13-week subchronic toxicity study was performed in Wistar Hannover rats at dose levels of 0 (control), 0.07, 0.31, 1.25 and 5% in powdered basal diet. The average of daily shea nut color intake was 51.3, 226.1, 986.8 and 3775.5 mg/kg/day for males and 56.4, 272.9, 1166.7 and 4387.7 mg/kg/day for females, respectively. During the administration period, daily observation of clinical signs and weekly measurement of body weights and food consumption were performed. After the end of the treatment, hematology, serum biochemistry, organ weight and histopathological examinations were conducted. No significant toxicological changes were observed in any parameters in this study. Hence, the no adverse effect dose of shea nut color was estimated to be greater than 5.0% for both sexes (3775.5 mg/kg/day for males and 4387.7 mg/kg/day for females).

Animals↗
PubMed2003

Preoperative blood pressure and catecholamines related to hypothermia during general anesthesia.

BACKGROUND: We previously demonstrated that preoperative blood pressure values affect intraoperative hypothermia during general anesthesia. We hypothesized that increased catecholamine secretion could be responsible for the relationship between preoperative blood pressure and hypothermia. METHODS: To evaluate the effect of preoperative systolic blood pressure (SBP) and plasma catecholamine levels on core temperature during general anesthesia, 40 male patients who were scheduled for open abdominal surgery were allocated to two groups: those whose preoperative SBP was 140 mmHg or greater (high SBP group, n = 20), and those whose SBP was less than 140 mmHg (normal SBP group, n = 20). Anesthesia was maintained with 0.4% isoflurane and opioids. RESULTS: The average age, height, and weight of the patients in the two groups did not differ. Preoperative SBP, mean blood pressure, diastolic blood pressure and heart rate in the high SBP group were significantly higher than those in the normal SBP group. Plasma norepinephrine concentrations in the high SBP group were significantly greater than those in the normal SBP group before and 1 h after the induction of anesthesia. Tympanic membrane temperatures in the normal SBP group started to decline further just after the induction of anesthesia, more so than that in the high SBP group. The vasoconstriction threshold in the normal SBP group was significantly lower than that in the high SBP group. CONCLUSION: These results suggest that the higher levels of preoperative catecholamine secretion contributed to the lesser degree of intraoperative hypothermia observed in the high SBP group.

Abdomen↗
PubMed2003

The vasoconstriction threshold is increased in obese patients during general anaesthesia.

BACKGROUND: In anaesthetized patients, body temperature decreases often, but overweight patients become less hypothermic. Obesity in itself protects body heat, and thermoregulatory reflexes may maintain normothermia in obese patients. We tested the hypothesis that even slight obesity increases the vasoconstriction threshold. METHODS: Twenty male patients aged 30-65 years scheduled for open abdominal surgery were allocated to two groups: body fat >/=25% (obese group, n = 10), or <25% (normal weight group, n = 10). Anaesthesia was maintained with 0.4% isoflurane and opioid. The thermoregulatory vasoconstriction threshold was defined by the tympanic membrane temperature at which the skin temperature gradient equalled 0 degrees C. Plasma adrenaline, noradrenaline and leptin were measured. RESULTS: Age, height, heart rate and blood pressure did not differ between the two groups of patients. In the obese group the vasoconstriction threshold was higher than that in the normal weight group: 36.0 +/- 0.1 vs. 35.5 +/- 0.2 degrees C. Consequently, after 4 h of anaesthesia, the core temperature was highest in the obese patients: 36.4 +/- 0.1 vs. 35.5 +/- 0.2 degrees C. CONCLUSIONS: These results suggest that core temperature is maintained in obese patients because their vasoconstriction threshold to a low environmental temperature is high.

Adult↗
PubMed2003

Aseptic meningitis during combined continuous spinal and epidural analgesia.

Continuous spinal analgesia (CSA) offers considerable advantages: (1) it requires 10% of the local anesthetic; (2) it may be instituted after patient positioning, thus minimizing the potential for cardiovascular instability; and (3) with low doses of dilute short-acting local anesthetic, the recovery period is shortened (1). Continuous spinal analgesia has been used for various procedures such as surgery and cancer pain control. However, CSA has not gained wide popularity because of its possible complications, such as headache, nerve injury, infection and accidental removal or migration of the catheter. Although real possibilities, these complications have been rarely documented. We describe an episode of aseptic meningitis during combined CSA and EA.

Abdominal Pain↗
PubMed2003

Phase I pharmacokinetic trial of the selective oral epidermal growth factor receptor tyrosine kinase inhibitor gefitinib ('Iressa', ZD1839) in Japanese patients with solid malignant tumors.

BACKGROUND: This phase I dose-escalating study investigated the tolerability and toxicity of the selective epidermal growth factor receptor tyrosine kinase inhibitor gefitinib ('Iressa', ZD1839) in Japanese patients with solid tumors. Thirty-one patients were included. PATIENTS AND METHODS: Patients initially received a single oral dose of gefitinib followed by 10-14 days of observation. Oral gefitinib was subsequently administered on 14 consecutive days, every 28 days. Dose escalation was from 50 mg/day to a maximum of 925 mg/day or dose-limiting toxicity (DLT). RESULTS: Most adverse events were mild (grade 1/2); the most frequent were an acne-like rash and gastrointestinal effects. Two of six patients at 700 mg/day had DLT; no further dose escalation occurred. C(max) was reached within 3-7 h and exposure to gefitinib increased with dose. Mean terminal half-life following multiple dosing was 50.1 h (range 27.8-79.7 h). A partial response (duration 35-361 days) was observed in five of the 23 patients with non-small-cell lung cancer over a range of doses (225-700 mg/day), and seven patients with a range of tumors had disease stabilization (duration 40-127 days). CONCLUSIONS: In conclusion, gefitinib showed a favorable tolerability profile in Japanese patients. The safety profile, pharmacokinetic parameters and antitumor activity observed in our study are comparable to those observed in patients from the USA and Europe.

Administration, Oral↗
PubMed2003

Assessment of myocardial viability using coronary zero flow pressure after successful angioplasty in patients with acute anterior myocardial infarction.

OBJECTIVES: To investigate the relation between coronary flow reserve (CFR), coronary zero flow pressure (Pzf), and residual myocardial viability in patients with acute myocardial infarction. DESIGNS: Prospective study. SETTING: Primary care hospital. PATIENTS: 27 consecutive patients with acute anterior myocardial infarction. MAIN OUTCOME MEASURES: F-fluorodeoxyglucose (FDG) positron emission tomography (PET) was used in 27 patients who underwent successful intervention within 12 hours of onset of a first acute anterior myocardial infarction. Within three days before discharge they had < 25% stenosis in the culprit lesion as determined by angiography 24 (3) days after acute myocardial infarction. Pzf and the slope index of the flow-pressure relation (SIFP) were calculated from the simultaneously recorded aortic pressure and coronary flow velocity signals at peak hyperaemia.%FDG was quantified by comparing FDG uptake in the infarct myocardium with FDG uptake in the normal myocardium. RESULTS: There was a correlation between %FDG and CFR, where y = -1.477x + 62.517, r = -0.072 (NS). There was also a correlation between %FDG and SIFP, where y = -0.975x + 60.542, r = -0.045 (NS), and a significant correlation between %FDG and Pzf, where y = -0.98x + 85.108, r = -0.696 (p < 0.001). CONCLUSIONS: CFR does not correlate with FDG-PET at the time of postreperfusion evaluation of residual myocardial viability. The parameter that correlates best with residual myocardial viability is Pzf and this may be a useful index for predicting patient prognosis.

Aged↗
PubMed2002

Dose- and time-response studies of sodium o-phenylphenate urinary bladder carcinogenicity in rats.

Dose- and time-response studies of urinary bladder carcinogenesis due to orally administered sodium o-phenylphenate (OPP-Na) were performed using 5-week-old male Fischer 344 rats given diets containing 0 (control), 2500, 5000, 10,000, 15,000 or 20,000 ppm OPP-Na for 104 weeks and fed basal diets until 112 weeks (experiment 1). In addition, rats received diets containing 20,000 ppm OPP-Na for 0 (control), 12, 24, 52 or 104 weeks and were killed at week 112 (experiment 2). In experiment 1, the transitional cell carcinoma (TCC) was the major tumor type in the urinary bladder, and the dose-response curve was steep with many tumors occurring at the high doses of 15,000 and 20,000 ppm. The virtually safe dose at a risk level of 10(-6) for TCCs and papillomas was estimated to be 144 ppm by the Weibull model, a high value similar to that for sodium saccharin. In experiment 2, a few TCCs developed after 24 weeks of treatment, but the time-response curve was also steep with the majority of lesions occurring after longer exposure periods. Based on the observed steepness in dose- and time-responses, any implied cancer risk of OPP-Na at the low doses of interest to man must be considered to be very small.

Agrochemicals↗
PubMed2002

A chronic toxicity study of josamycin in F344 rats.

The chronic toxicity of josamycin was examined in Fischer 344 (F344) rats. Groups of 10 males and 10 females were given the test compound in the diet at concentrations of 0 (control), 0.02, 0.1, 0.5 or 2.5% for 52 weeks. Daily intake of josamycin was 0, 10, 50, 260 and 1310 mg/kg body weight in males and 0, 10, 60, 290 and 1460 mg/kg body weight in females, respectively. Body weight gain was significantly (P<0.05) reduced in the male 2.5% group but no noticeable changes were found in food intake. In hematological examination, the platelet count was significantly (P<0.01) lower in the male groups given 0.02% or more of josamycin and in the 2.5% female group as compared with the control group values in a dose-dependent manner. In serum biochemical examination, blood urea nitrogen was significantly (P<0.05 and P<0.01, respectively) higher in males given 0.5 and 2.5% and total bilirubin was significantly (P<0.05) higher in females receiving 2.5% as compared with those of the control group. No death occurred at any dose levels during the dosing period. At necropsy, with the exception of cecal enlargement in the groups given more than 0.1% josamysin and a significant (P<0.01) increase in the relative liver weight of females in the 2.5% group, no particular findings related to the administration were observed. Histopathologically, the incidence and severity of liver bile duct proliferation in female 2.5% group were significantly (P<0.01) greater than those of the control group. Other histological changes found in the treated and control groups were similar to the spontaneous lesions in this strain of rats in terms of the incidence and severity. Interestingly, the josamycin treatment reduced the development of altered liver cell foci in females in a dose-dependent manner. Thus, it is concluded that, under the present experimental conditions, josamycin induces bile duct proliferation in female F344 rats at a high dose of 1460 mg/kg body weight. Based on the decrease of platelet count found in males given 10 mg/kg body weight or more, the no-observed-adverse-effect level (NOAEL) was estimated to be less than 10 mg/kg body weight.

Animals↗
PubMed2002

Iron lactate induction of pancreatic and endometrial proliferative lesions and a lack of increased tumors in a 104-week carcinogenicity study in F344 rats.

Iron lactate has been used as a food additive for iron supplementation. The present study was conducted to determine whether it might have carcinogenic potential. A total of 150 male and 150 female Fischer 344 rats were divided into three groups and fed basal diet containing 0, 1 or 2% of iron lactate for 104 weeks. No iron lactate-induced tumors were observed in any groups, although the incidences of pancreatic acinar cell and endometrial gland hyperplasias were increased in males and females, respectively, in the 2% group. Thus our in vivo animal data indicate that iron lactate lacks carcinogenicity in male and female F344 rats. However, estrogenic effects might be concluded based on the data for endometrial lesions. In a second experiment, an estrogen responsive rat pituitary tumor cell line, MtT/Se, and a human breast cancer cell line, MCF-7, were therefore employed to examine the estrogenic potential of iron lactate with regard to receptor binding affinity and ERE-reporter gene activation. Results in both cases were negative. Further investigations are needed to elucidate the mechanisms of induction of pancreatic and endometrial proliferative lesions by iron lactate.

Animals↗
PubMed2002

Inhibition of proliferation of gastric epithelial cells by a cyclooxygenase 2 inhibitor, JTE522, is also mediated by a PGE2-independent pathway.

BACKGROUND: Cyclooxygenase-2 (COX-2) is one of the rate-limiting enzymes for prostaglandin synthesis from arachidonic acid. Although it is known that inhibition of cyclooxygenase activity delays ulcer healing, the regulatory relationship between COX-2 and its metabolites in gastric epithelial cell proliferation is not well known. AIM: To investigate whether COX-2 has an effect on gastric mucosal cell proliferation and further studied whether such effect is mediated only by prostaglandin E2 (PGE2), a representative metabolite of arachidonates in the gastric mucosa. METHODS: Artificial wounds of defined area size were created on complete monolayer cell sheets of isolated rat gastric epithelial cells and rat gastric cell line RGM1 under the addition of arachidonic acid or a COX-2 selective inhibitor, JTE522. Repair of wounds was assessed by monitoring wound size, with cell proliferation detected using 5-bromodeoxyuridine staining. Quantity of secreted PGE2 was measured by enzyme immunoassay. RESULTS: Stimulation of foetal calf serum increased the expression of COX-2 protein and inhibition of COX-2 retarded wound healing with reduction of cell proliferation. Arachidonic acid increased PGE2 production and accelerated restoration. Combination of JTE522 and arachidonic acid resulted in a marked retardation of wound healing compared to the control, but JTE522 did not completely suppress the increase in cellular PGE2 content following the addition of arachidonate. CONCLUSIONS: The difference in the effects of JTE522 on PGE2 production and on wound healing suggest that the involvement of COX-2 in gastric epithelial cell proliferation is not mediated solely by PGE2.

Animals↗
PubMed2002

Preoperative risk factors of intraoperative hypothermia in major surgery under general anesthesia.

UNLABELLED: Preoperative factors, such as age and body habitus, affect intraoperative hypothermia during general anesthesia. In a preliminary study, we developed a logistic model to retrospectively evaluate predictors of intraoperative hypothermia in patients who received major surgery. The following factors were selected to develop the model: Z = -15.014 + 0.097 x (Age) + 0.263 x (Height) - 0.323 x (Weight) - 0.055 x (Preoperative systolic blood pressure) - 0.121 x (Preoperative heart rate). By using this model, the probability of hypothermia can be estimated by applying the following formula: Probability = 1/(1 + e(-)(Z)). If an estimated probability of hypothermia was >0.5, the sensibility of prediction was 81.5% and the specificity was 83%. In the second study, the model was applied prospectively to other patients, and the validity of the logistic model was evaluated. The core temperature showed a significant decrease in patients with a probability >0.7, who were predicted to be hypothermic, and their thermoregulatory vasoconstriction threshold also showed a significant decrease, compared with the patients with a probability <==0.3, who were predicted to be normothermic. We concluded that intraoperative hypothermia could be predicted from preoperative characteristics such as age, height, weight, systolic blood pressure, and heart rate. IMPLICATIONS: Increases in age and height and decreases in weight systolic blood pressure and heart rate are major preoperative risk factors of intraoperative hypothermia during major surgery.

Aged↗
PubMed2002

Spontaneous development of aberrant crypt foci in F344 rats.

Aberrant crypt foci (ACF) have been proposed as intermediate biomarkers for colon carcinogenesis on the basis of many rodent studies. Although molecular analyses have indicated that these lesions in experimental animals are related to early events in colon carcinogenesis, their preneoplastic nature has yet to be fully elucidated. In the present study, one hundred and thirty 19-week-old male Fischer 344 rats were examined. The biological characteristics of spontaneous ACF were analyzed histopathologically, immunohistochemically and with molecular biological techniques, and compared with colon tumors found in control groups used for carcinogenicity tests. The incidences of spontaneous ACF consisting of 1, 2, 3 and 4 or more crypts were respectively 27.7%, 32.5%, 16.8% and 22.8%. Most ACF were distributed in the lower middle and upper distal colon, and proximal colon ACF was rare. Likewise, ACF frequently (42.5%) developed in untreated animals, whereas the incidence of spontaneous colorectal tumors was extremely low (0.68%) in control male rats. In addition, spontaneous ACF did not show apparent proliferative activity or c-K-ras point mutations. Our results thus suggest that spontaneous ACF rarely progress to colon tumors although long-term sequential observation might be necessary to conclude the significance of ACF.

Adenocarcinoma↗
PubMed2001

Altered psychomotor behaviors in mice lacking pituitary adenylate cyclase-activating polypeptide (PACAP).

Pituitary adenylate cyclase-activating polypeptide (PACAP) has been conserved remarkably during evolution and is widely expressed in the mammalian brain. In Drosophila, mutation of the PACAP homologue results in behavioral defects, including impaired olfaction-associated learning and changes in ethanol sensitivity. Here, we report the generation of mice lacking the PACAP gene (PACAP(-/-)). PACAP(-/-) mice were born in the expected Mendelian ratios but had a high early-mortality rate. The surviving adult PACAP(-/-) mice displayed remarkable behavioral changes; they exhibited hyperactive and explosive jumping behaviors in an open field, increased exploratory behavior, and less anxiety in the elevated plus maze, emergence, and novel-object tests. Analysis of PACAP(-/-) mice brains revealed that the serotonin metabolite 5-hydroxyindoleacetic acid was slightly decreased in the cortex and striatum compared with wild-type mice. The present study provides evidence that PACAP plays a previously uncharacterized role in the regulation of psychomotor behaviors.

Animals↗
PubMed2001

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method.

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).

DNA↗
PubMed2001

Involvement of p38 MAP kinase pathway in the synergistic activation of PACAP mRNA expression by NGF and PACAP in PC12h cells.

We have recently shown that in PC12 cells, PACAP and NGF synergistically increase PACAP gene transcription and mRNA level, and that the MAPK/ERK kinase inhibitor PD98059 blocks the PACAP mRNA expression induced by either PACAP or NGF, but not that induced by the combination, suggesting involvement of multiple signaling pathways. Here we show that the p38 MAPK inhibitor SB203580 almost completely inhibits the PACAP mRNA expression induced by PACAP alone or in combination with NGF. PACAP induces neurite outgrowth and potentiates NGF-induced neurite outgrowth in PC12h cells. Unlike the case for the PACAP mRNA expression, SB203580 did not affect, but PD98059 reduced, PACAP and NGF-induced neurite outgrowth. These results indicate that PACAP receptors are coupled to the p38 signaling pathway, and that p38 plays a key role in the regulation of PACAP gene expression, while ERK, but not p38, MAPK is involved in PACAP and NGF-induced neurite outgrowth.

Animals↗