Search PubMed⌕ Search

Biomedical subjects

M H Caruthers

Publications and source records attributed to M H Caruthers.

At least 19 recordsLinked to original sources
PubMed1979

Studies on gene control regions XII. The functional significance of a lac operator constitutive mutation.

The functional significance of a lac operator constitutive mutation has been determined. The transition adenine-thymine to guanine-cytosine was shown to be a constitutive mutation simply because thymine contains the functionally important 5-methyl group whereas cytosine does not. The remainder of the base pair is of no consequence. The experimental approach was to synthesize various modified operators containing cytosine, 5-methyl-cytosine, and 5-bromocytosine. The synthetic operator containing a guanine-cytosine base pair displays an eightfold reduction in stability with lac repressor whereas the operator containing 5-methylcytosine binds repressor at least as tightly as does the wild type sequence. Results published previously have shown that a similar decrease in stability of the repressor-operator complex can be obtained simply by substituting uracil for thymine or by inverting the base pair to thymine-adenine. All these results taken together implicate the thymine 5-methyl as the only important functional group recognized by the lac repressor at this base pair. Further confirmation of this conclusion was obtained by substitution of 5-bromocytosine and 5-bromouracil at this base pair. Both altered the stability of the repressor-operator complex by about the same percent suggesting that the bromine atom was the important determinant of complex stability for 5-bromopyrimidine analogs.

Base Sequence↗
PubMed1979

Studies on gene control regions X. The effect of specific adenine-thymine transversions on the lac repressor-lac operator interaction.

Chemical and enzymatic methods were used to synthesize a transition (AT to GC) and a transversion (AT to TA) at a lac operator site known to interact with lac repressor through the thymine 5 methyl group. These operators also contained a poly(dA) . poly(dT) tail 8 to 12 base pairs in length at one end. Results suggest that the steric constraints of lac repressor relative to the position of the 5 methyl group are quite critical. For example a seven fold reduction in stability was observed for the transversion. Results also suggest that the operator spans at least 21 base pairs.

Adenine↗
PubMed1978

Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators.

A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.

Base Sequence↗
PubMed1978

How lac repressor recognizes lac operator.

Nucleotide analogs were substituted for unmodified nucleotides at specific sites in the lac operator sequence by a combination of chemical and enzymatic procedures. The nitrocellulose filter assay was used to study the interactions of these modified operators with wild-type (SQ) and tight-binding (QX86) lac repressors. These studies implicate directly the 5 methyl of thymine and the 2 amino of guanine as important operator-repressor contact sites. Furthermore, when these findings are combined with published results from other laboratories, a model for the lac operator-lac repressor interaction can be derived. Two important postulates follow from this model. (i) The repressor interacts at specific and defined sites with the N7 of guanine, the 5 methyl of thymine, the 2 amino of guanine, and the central major groove of the operator. (ii) The repressor binds to one side of the operator.

Base Sequence↗
PubMed1977

Synthesis and biological activity of a lambda pseudo operator.

The chemical and enzymatic syntheses of bacteriophage lambda pseudo operator DNA are described. The 17 base-paired duplex contains the DNA which has been proposed as the binding site for cI repressor protein. The synthetic duplex is twofold symmetric and represents the best possible nucleotide summation of the six proposed operator sites in the leftward and rightward operators. However, it does not correspond exactly to any single proposed operator sequence. The chemical synthesis includes the deoxyoligonucleotides d(T-A-T-C-A-C), d(C-G-C-C-G-G-T-G-A-T-A), d(T-A-T-C-A-C-C), and d(G-G-C-G-G-T-G-A-T-A). These deoxyoligonucleotides were joined with T4 DNA ligase to form d(T-A-T-C-A-C-C-G-C-C-G-G-T-G-A-T-A) and d(T-A-T-C-A-C-C-G-G-C-G-G-T-G-A-T-A). The cI repressor protein was found to bind to the duplex formed from these two segments.

Base Sequence↗
PubMed1977

Studies on gene control regions. 1. Chemical synthesis of lactose operator deoxyribonucleic acid segments.

The chemical synthesis of lactose operator DNA segments is described. The 31-base-paired duplex contains the DNA recognized by lac repressor protein and twofold rotationally symmetric base pairs on either side of the tight binding region. The synthesis includes the deoxyoligonucleotides d(T-G-T-G-G), d(A-A-T-T-G-T-G-A-G), d(C-G-G-A-T-A-A-C-A-A-T-T), d(T-C-A-C-A), d(T-G-T-G-A-A-A-T-T-G-T), d(T-A-T-C-C-G-C-T-C-A-C), and d(A-A-T-T-C-C-A-C-A). These deoxyoligonucleotides were characterized by two-dimensional sequencing techniques, paper chromatography, and thin-layer chromatography.

Base Sequence↗
PubMed1977

Studies on gene control regions. 2. Enzymatic joining of chemically synthesized lactose operator deoxyribonucleic acid segments.

The T4 polynucleotide ligase catalyzed joining of six chemically synthesized deoxypolynucleotides corresponding to lactose operator DNA has been investigated. Joining was studied using various combinations of segments. Joining reactions involving multiple sites and the formation of duplex operator DNA were complete in a few hours. Joining reactions involving a single site and the formation of only one strand of operator DNA required several days and repeated annealing in order to go to completion. These studies have permitted the synthesis on a preparative scale (several nanomoles) of operator duplexes and operator single strands.

Coliphages↗
PubMed1977

Cloning of chemically synthesized lactose operators.

Recombinant DNA molecules, constructed from the ColE1-Mk5 hybrid plasmid PMB9 and a chemically synthesized wild-type lactose operator segment, have been used to transform Escherichia coli. Up to 10% of the transformants (selected for the tetracycline-resistance property of PMB9) are partially constitutive for the lactose operon enzyme beta-galactosidase. In vitro studies demonstrate that these partially constitutive transformants contain plasmid DNA molecules which carry one or more lactose operators, and which will bind purified lactose repressor. Preliminary results with some modified operator sequences are also presented.

Coliphages↗
PubMed1977

Binding of synthetic lactose operator DNAs to lactose represessors.

The nitrocellulose filter assay was used to study the interactions of wild-type (SQ) and tight-binding (QX86) lac repressors with synthetic lac operators 21 and 26 base pairs long. The repressor binding properties of both operators were very similar, indicating that both contain the same specific repressor recognition sites. The repressor-operator association rate constants (k(a)) were more sensitive than dissociation rate constants (k(d)) to changes in ionic strength. The responses of both k(a) and k(d) to ionic strength were relatively small compared to the effects previously observed with lambdah80dlac as operator DNA. These results suggest that under natural conditions there are electrostatic interactions between lac repressor and DNA regions outside of the 26 base pair operator sequence. Association rate constants for SQ repressor with either operator are higher than have been predicted for diffusion-limited reactions. We postulate that long-range electrostatic attractions between repressor and operator accelerate the association reaction. The presence of nonoperator DNA decreased association rate constants, the effect being more noticeable at an ionic strength of 0.05 M than at 0.20 M. Nonoperator DNA reduced k(a) values for associations involving QX86 repressor to a greater extent than for those with SQ repressor. The two types of repressors also had different rate constants for interactions with synthetic operators. The values for k(a) and k(d) were both higher with SQ repressor than with QX86 repressor. However, the rate constants were more sensitive to ionic strength when the repressor used was QX86.

Chemical Phenomena↗
PubMed1977

Studies of gene control regions. III. Binding of synthetic and modified synthetic lac operator DNAs to lactose repressor.

Chemically synthesized lactose operator DNA was tested for binding with lactose repressor protein. These operator DNAs were found to (1) bind specifically to lactose SQ repressor as measured by release of binding with the inducing ligand isopropyl-beta-D-thiogalactoside, (2) have dissociation half-lives of 37 seconds (21 base-paired duplex) and 46 seconds (26 base-paired duplex) and (3) have dissociation half-lives with x86 repressor of 9 minutes (21 base-paired duplex) and 18 minutes (26 base paired duplex). Modified operators containing 5-bromodeoxyuridine and deoxyuridine at specific sites were also prepared. These analogs bound both repressors about as tightly as the wild type sequence.

Base Sequence↗
PubMed1976

Total synthesis of the structural gene for the precursor of a tyrosine suppressor transfer RNA from Escherichia coli. 3. Synthesis of deoxyribopolynucleotide segments corresponding to the nucleotide sequence 27-51.

Chemical syntheses of the four deoxyribodecanucleotides, d(T-C-G-A-A-G-T-C-G-A), d(C-G-T-C-A-T-C-G-A-C), d(T-G-A-C-G-G-C-A-G-A), and d(C-T-A-A-A-T-C-T-G-C) are described. These polynucleotides form, respectively, segments 7 to 10 in the plan adopted for the total synthesis of the DNA corresponding to the precursor for the Escherichia coli tyrosine tRNA. The syntheses used the principles of stepwise addition of protected mono- and oligonucleotides to the 3'-hydroxyl end of growing oligonucleotide chains. Detailed schemes used in the present syntheses are shown in Diagrams 1 to 4 in the text. The final products were subjected to extensive chromatography and were characterized as pure by chemical and enzymatic procedures.

Base Sequence↗
PubMed1976

Total synthesis of the structural gene for the precursor of a tyrosine suppressor transfer RNA from Escherichia coli. 10. Enzymatic joining of chemically synthesized segments to form the DNA duplex corresponding to the nucleotide sequence 86-126.

The polynucleotide ligase-catalyzed joining of the eight chemically synthesized deoxypolynucleotides (segments 19 to 26), comprising the nucleotide sequence 86-126 of the DNA corresponding to the Escherichia coli tyrosine tRNA precursor has been investigated. Joining was studied using various combinations of 3, 4, or larger number of segments at a time. The extent of joining was in general low (0 to 40%) for the three-component as well as for the four-component systems. Joining of the five- and six- component systems was more satisfactory with yields from 25 to about 60%. The three duplexes [IVa] to [IVc]were prepared in single step reactions in yields of about 50% and were characterized. Duplex [IVd] could not be prepared in a single step reaction because of the failure of 5'-phosphorylated segment 26 to join to the rest of the duplex. Using a carefully annealed mixture of segments 24, 25, and phosphorylated segment 26, the joining of the latter to segment 24 could be realized in about 25% yield, much activated intermediate being concurrently present.

Adenosine Triphosphate↗
PubMed1976

Total synthesis of the structural gene for the precursor of a tyrosine suppressor transfer RNA from Escherichia coli. 11. Enzymatic joining to form the total DNA duplex.

The DNA duplex corresponding to the entire length (126 nucleotides) of the precursor for an Escherichia coli tyrosine tRNA has been synthesized. Duplex [I] (Sekiya, T., Besmer, P., Takeya, T., and Khorana, H. G.(1976) J. Biol. Chem. 251, 634-641), corresponding to the nucleotide sequence 1-26, containing single-stranded ends and carrying one appropriately labeled 5'-phosphate group, was joined to duplex [II] (Loewen, P. C., Miller, R. C., Panet, A., Sekiya, T., and Khorana, H. G. (1976) J. Biol. Chem. 251, 642-650) (nucleotide sequence 23-66 or 23-60) was phosphorylated with [gamma-33P]ATP at the 5'-OH ends. Duplex [III] (Panet, A., Kleppe, R., Kleppe, K., and Khorana, H. G. (1976) J. Biol. Chem. 251, 651-657) (nucleotide sequence 57-94 (Fig. 2)) was also phosphorylated at 5'-ends with [gamma-33P]ATP and was joined to duplex [IV] (Caruthers, M. H., Kleppe, R., Kleppe, K., and Khorana, H. G. (1976) J. Biol. Chem. 251, 658-666) (nucleotide sequence 90-126) which carried a 33P-labeled phosphate group on nucleotide 90. The joined product, duplex [III + IV] (nucleotide sequence 57-126) was characterized. The latter duplex was joined to the duplex [I + II] to give the total duplex. The latter contains singlestranded ends (nucleotides 1 to 6 and 121 to 126) which can either be "filled in" to produce the completely base-paired duplex or may be used to add the promoter and terminator regions at the appropriate ends.

Base Sequence↗
PubMed1976

Total synthesis of the structural gene for the precursor of a tyrosine suppressor transfer RNA from Escherichia coli. 1. General introduction.

With the ultimate objective of the total synthesis of a tRNA gene including its transcriptional signals, an Escherichia coli tyrosine suppressor tRNA gene was chosen. The arguments in favor of this choice are presented. A plan for the total synthesis of the 126-nucleotide-long DNA duplex corresponding to a precursor (Altman S., and Smith, J. D. (1971) Nature New Biol. 233, 35) to the above tRNA is formulated. The plan involves: (a) the chemical synthesis of 26 deoxyribooligonucleotide segments, (b) polynucleotide ligase-catalyzed joining of several segments at a time to form a total of four DNA duplexes with appropriate comlementary single-stranded ends, and (c) the joining of the duplexes to form the entire DNA duplex. Ten accompanying papers describe the experimental realization of this objective.

Base Sequence↗
PubMed1976

Total synthesis of the structural gene for the precursor of a tyrosine suppressor transfer RNA from Escherichia coli. 2. Chemical synthesis of the deoxypolynucleotide segments corresponding to the nucleotide sequence 1-31.

Chemical synthesis of the undecanucleotides d(T-G-G-G-G-G-A-A-G-G-A), d(C-C-C-C-A-C-C-A-C-C-A), and d(T-C-G-A-A-T-C-C-T-T-C), and the nonanucleotides, d(T-T-C-G-A-A-C-C-T) and d(T-T-C-G-A-A-G-G-T) are described. The deoxyribopolynucleotides together represent the DNA duplex corresponding to the nucleotide sequence 1-31 (from the 3'-end) of the gene for the tyrosine suppressor tRNA. The synthesis, which basically used the previously developed chemical methods, started with 5' and N-protected deoxyribonucleosides. Successive condensations at the 3'-end were performed using suitably protected mononucleotides or preformed di- and trinucleotides. The condensing agents used were mesitylenesulfonyl chloride or triisopropyl benzenesulfonyl chloride. The required condensation products were isolated partly by solvent partition methods or, in the case of longer chains, by anion exchange chromatography. The completely deprotected deoxypolynucleotides were further purified by anion exchange chromatography in the presence of 7 M urea and characterized by chemical and enzymatic methods.

Base Sequence↗