Search PubMed⌕ Search

Biomedical subjects

M G Mattei

Publications and source records attributed to M G Mattei.

At least 253 records · Page 14Linked to original sources
PubMed1991

Human type VII collagen: cDNA cloning and chromosomal mapping of the gene.

A human keratinocyte cDNA expression library in bacteriophage lambda gt11 was screened with the purified IgG fraction of serum from a patient with epidermolysis bullosa acquisita, which had a high titer of anti-type VII collagen antibodies. Screening of approximately 3 x 10(5) plaques identified 8 positive clones, the largest one (K-131) being approximately 1.9 kilobases in size. Dideoxynucleotide sequencing of K-131 indicated that it consisted of 1875 base pairs and contained an open reading frame coding for a putative N-terminal noncollagenous domain of 439 amino acids and a collagenous C-terminal segment of 186 amino acids. The collagenous domain was characterized by repeating Gly-Xaa-Yaa sequences that were interrupted in several positions by insertions or deletions of 1-3 amino acids. The deduced amino acid sequence also revealed a peptide segment that had a high degree of identity with a published type VII collagen protein sequence. Northern hybridization of the K-131 cDNA with human epidermal keratinocyte and skin fibroblast RNA revealed an mRNA of approximately 8.5 kilobases. The fusion protein produced by the K-131 cDNA, when incubated with epidermolysis bullosa acquisita serum, bound to antibodies that reacted in Western blots with type VII collagen. The genomic location of the type VII collagen gene (COL7A1) was determined by chromosomal in situ hybridization with the K-131 cDNA. The results mapped the COL7A1 to the locus 3p21. The cDNA clones characterized in this study will be valuable for understanding the protein structure and gene expression of type VII collagen present in anchoring fibrils and its aberrations in the dystrophic forms of heritable epidermolysis bullosa.

Amino Acid Sequence↗
PubMed1991

Linkage of Marfan syndrome and a phenotypically related disorder to two different fibrillin genes.

Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by skeletal, cardiovascular and ocular abnormalities. The incidence of the disease is about 1 in 20,000, with life expectancy severely reduced because of cardiovascular complications. As the underlying defect is unknown, MFS diagnosis is based solely on clinical criteria. Certain phenotypic features of MFS are also shared by other conditions, which may be genetically distinct entities although part of a clinical continuum. Immunohistochemical studies have implicated fibrillin, a major component of elastin-associated microfibrils, in MFS aetiology. Genetic linkage analysis with random probes has independently localized the MFS locus to chromosome 15. Here we report that these two experimental approaches converge with the cloning and mapping of the fibrillin gene to chromosome 15q15-21, and with the establishment of linkage to MFS. We also isolated a second fibrillin gene and mapped it to chromosome 5q23-31. We linked this novel gene to a condition, congenital contractural arachnodactyly, that shares some of the features of MFS. Thus, the cosegregation of two related genes with two related syndromes implies that fibrillin mutations are likely to be responsible for different MFS phenotypes.

Amino Acid Sequence↗
PubMed1991

Two members of an HNF1 homeoprotein family are expressed in human liver.

HNF1 is a transcriptional activator, required for the liver-specific expression of a variety of genes, that binds to DNA as a dimer via the most diverged homeodomain known so far. We were interested to examine whether HNF1 is a unique homeoprotein example or whether it is the prototype of a new subfamily of homeodomain containing proteins. In this work we describe the isolation of a cDNA clone from a human liver library encoding a protein, highly homologous to HNF1 in three regions, including the homeo- and dimerization domains. We show that this protein can heterodimerize with human HNF1 in vitro. Sequence comparison of our clone with a rat variant HNF1 (vHNF1) clone, isolated in parallel in our laboratory from the dedifferentiated H5 hepatoma cell line, identified our cDNA as human vHNF1. vHNF1 is a nuclear protein recognizing the same binding site as HNF1 and previously thought to occur only in dedifferentiated hepatoma cells that fail to express most liver specific genes. Nevertheless, we show by Northern blot analysis that vHNF1 transcripts are present in differentiated human HepG2 hepatoma cells as well as in rat liver and that this transcript level is 10-20 fold lower than that of HNF1. We assigned the vHNF-1 gene to human chromosome 17 and murine chromosome 11. These chromosomal localizations differ from that of the HNF-1 gene indicating that both genes are not clustered on the genome.

Amino Acid Sequence↗
PubMed1991

The complete primary structure of the human alpha 1 (VIII) chain and assignment of its gene (COL8A1) to chromosome 3.

Type VIII collagen molecules, expressed by corneal and vascular endothelial cells, appear to be heterotrimers composed of two genetically distinct polypeptides, alpha 1 (VIII) and alpha 2(VIII), in the ratio of 2:1. Characterization of the rabbit alpha 1(VIII) gene has demonstrated that it consists of only four exons, one of which is large and encodes the entire triple-helical and carboxyl non-triple-helical domains. A similar exon organization has been found for the chicken alpha 1(X) and the mouse and human alpha 2(VIII) collagen genes. The genes encoding alpha 1(VIII), alpha 2(VIII), and alpha 1(X) collagen chains are therefore homologous members of a unique class of genes within the collagen superfamily. In the present paper we describe for the first time the primary structure of the human alpha 1(VIII) collagen chain, based on isolation and sequencing of a genomic DNA fragment. The results indicate that the human alpha 1(VIII) chain has the same domain structure as the rabbit protein. We also demonstrate that the gene is localized on the long arm of the human chromosome 3. The availability of genomic DNA encoding the human alpha 1(VIII) collagen chain and information about its chromosomal location should make it possible to examine whether hereditary diseases are linked to abnormalities in the structure or expression of the alpha 1(VIII) gene.

Amino Acid Sequence↗
PubMed1991

Cloning of human alpha 1(X) collagen DNA and localization of the COL10A1 gene to the q21-q22 region of human chromosome 6.

With consensus primers based upon the nucleotide sequence of the chicken alpha 1(X) collagen gene, we have used PCR with human genomic DNA as template to isolate a 289 bp fragment coding for part of the carboxyl non-triple helical domain of the human alpha 1(X) gene. We have demonstrated the presence of the sequence of the PCR clone within the human genome by partial sequence analysis of a 1 kb HindIII genomic DNA fragment that hybridized with the PCR clone. Furthermore, using the PCR clone as a probe for in situ hybridization of human metaphase chromosome spreads, and for Southern analysis of a panel of human-hamster somatic cell hybrid DNAs, we have assigned the locus for the alpha 1(X) gene to the q21-q22 region of human chromosome 6.

Amino Acid Sequence↗
PubMed1991

The alpha 2(VIII) collagen gene. A novel member of the short chain collagen family located on the human chromosome 1.

Type VIII collagen is a major component of Descemet's membrane, the specialized basement membrane of corneal endothelial cells. Sequence analysis of a cDNA isolated from a library made with mRNA from rabbit corneal endothelial cells has indicated that type VIII molecules contain a polypeptide chain, alpha 1(VIII), consisting of a short triple-helical domain of 454 amino acid residues flanked by non-triple-helical domains of 117 and 173 amino acid residues at the amino and carboxyl ends, respectively (Yamaguchi, N., Benya, P. D., van der Rest, M., and Ninomiya, Y. (1989) J. Biol. Chem. 264, 16022-16029). The sequence of alpha 1(VIII) is strikingly similar to that of alpha 1(X) collagen, a product of hypertrophic chondrocytes. Also, characterization of the alpha 1(VIII) and alpha 1(X) collagen genes has shown that they are quite similar in their exon organization. It has been concluded, therefore, that they are homologous members of a distinct subclass of collagen genes (Yamaguchi, N., Mayne, R., and Ninomiya, Y. (1991) J. Biol. Chem. 266, 4508-4513). We have given this subclass the name short chain collagens because of the relatively small size of the triple-helical domain. In the present study, we report on the identification and characterization of a collagen gene encoding a polypeptide which is co-expressed with the alpha 1(VIII) chain in corneal endothelial cells. This collagen chain contains a triple-helical and a carboxyl non-triple-helical domain encoded by a single, large exon both in mice and humans. We conclude, therefore, that the genes encodes a novel member of the short chain collagen family, and we have given this chain the designation alpha 2(VIII) collagen. By in situ hybridization we demonstrate that the alpha 2(VIII) gene is located in the p32.3-p34.3 region of the short arm of chromosome 1.

Amino Acid Sequence↗
PubMed1991

The KUP gene, located on human chromosome 14, encodes a protein with two distant zinc fingers.

We have isolated a human cDNA (kup), encoding a new protein with two distantly spaced zinc fingers of the C2H2 type. This gene is highly conserved in mammals and is expressed mainly in hematopoietic cells and testis. Its expression was not higher in the various transformed cells tested than in the normal corresponding tissues. The kup gene is located in region q23-q24 of the long arm of human chromosome 14. The kup protein is 433 a.a. long, has a M.W. close to 50 kD and binds to DNA. Although the structure of the kup protein is unusual, the isolated fingers resemble closely those of the Krüppel family, suggesting that this protein is also a transcription factor. The precise function and DNA motif recognized by the kup protein remain to be determined.

Amino Acid Sequence↗
PubMed1991

Gene structure and chromosomal localization of plasma kallikrein.

Plasma kallikrein (Fletcher factor) is a hepatic serine proteinase that participated in the early phase of blood coagulation. From two genomic libraries, we succeeded to isolate four overlapping clones representing the entire rat plasma kallikrein gene. Using selective DNA sequencing, polymerase chain reactions, and restriction mapping, we demonstrated that the gene for rat plasma kallikrein was 22 kb in length. Similar to human factor XI [Asakai et al. (1987) Biochemistry 26, 7221-7228], we also found that the plasma kallikrein gene is composed of 15 exons and 14 introns. A potential transcription initiation step was determined by a novel application of the polymerase chain reaction technique. Computer analysis of the 5'-promoter region of this gene revealed some putative control elements that might regulate the rat plasma kallikrein gene expression. These data and the results of chromosomal localization reported in the present study for mouse (chromosome 8) and human (chromosome 4) plasma kallikrein genes strongly corroborate a genic duplication event from a common ancestor to both plasma kallikren and factor XI.

Amino Acid Sequence↗
PubMed1991

Molecular cloning and chromosomal localization of a human peripheral-type benzodiazepine receptor.

The sequencing of endopeptidase-generated peptides from the peripheral binding site (PBS) for benzodiazepines, purified from a Chinese hamster ovary (CHO) cell line, produced internal sequence information, and confirmed and extended the NH2-terminal PBS sequence that we previously reported. Since the sequences were highly similar to the corresponding rat PBS sequences, we investigated whether they were also conserved in human PBS. Scatchard analysis of [3H]PK11195 (a derivative of isoquinoline carboxamide) binding and photoaffinity labeling with [3H]PK14105 (a nitrophenyl derivative of PK11195) revealed that CHO PBS and human PBS are closely related. Furthermore a rabbit antiserum raised against three peptides synthesized on the basis of the CHO PBS sequence immunoprecipitate the solubilized U937 PBS and also recognize the human protein in an immunoblot analysis. Based on these results, we screened a U937 cell cDNA library with four oligonucleotide probes derived from the CHO sequence. Two of the probes hybridized with several clones that we isolated and sequenced. One of these, h-pPBS11, is 831 nucleotides and contains a full-length representation of human PBS mRNA. The amino acid sequence of human PBS deduced from the cDNA is 79% identical to that reported for rat PBS, however, human PBS contains two cysteines while rat PBS is characterized by the absence of this amino acid. Using the cDNA of human PBS as a probe, the PBS gene was located in the 22q13.3 band of the human genome.

Amino Acid Sequence↗
PubMed1991

Molecular characterization of the mouse beta 3-adrenergic receptor: relationship with the atypical receptor of adipocytes.

The gene encoding the murine beta 3-adrenergic receptor (beta 3AR) has been isolated. It translates into a polypeptide of 388 amino acid residues which shows 82% overall homology with the human beta 3AR. In Southern blot experiments, a probe derived from the murine beta 3AR gene hybridizes to a unique restriction fragment in the murine and human genomes. In both species, the beta 3AR gene is located on chromosome 8, in regions (8A2----8A4 in mouse, and 8p11----8p12 in man) which are conserved between mouse and man. The pharmacological profile of the mouse beta 3AR strongly resembles that of the human beta 3AR. It is characterized by a low affinity toward the radiolabelled beta-adrenergic antagonist [125I]Iodocyanopindolol and a low efficiency of other antagonists such as propranolol, ICI 118551 or CGP 20712A to inhibit cAMP production induced by isoproterenol. Another salient feature shared by the murine and the human beta 3ARs is the very potent effect of the lipolytic compound BRL 37344 on cAMP accumulation and the partial agonistic effect of the beta 1- and beta 2-adrenergic antagonists CGP 12177A, oxprenolol and pindolol. These properties are very close to those ascribed to the atypical beta AR of rodent adipocytes. In addition, Northern blot analyses indicate that the beta 3AR gene is mainly expressed in mouse brown and white adipose tissues, suggesting that the murine beta 3AR described here is the atypical beta AR involved in the control of energy expenditure in fat tissue.

3T3 Cells↗
PubMed1991

Tg (9 HSA-MYC), a homozygous lethal insertion in the mouse.

Transgenic mice generated with different DNA sequences were surveyed for possible homozygous mutant phenotypes. We found an embryonic lethal mutation in the transgenic mouse strain (MT-MYC12.4) containing the human c-myc gene. Embryos homozygous for the transgene die shortly after implantation. The strain MT-MYC12.4 carries approximately 50 tandem copies of the recombinant plasmid sequence. The 3' flanking sequence has been cloned and analyzed. It contains a unique sequence that has been conserved during evolution and maps to Chromosome (Chr) 9. This mutant has been designated Tg 9 (HSA-MYC).

Animals↗
PubMed1991

Assignment by in situ hybridization of a fibroblast growth factor receptor gene to human chromosome band 10q26.

A 2.3-kb cDNA probe for the human bek fibroblast growth factor receptor was used to determine the chromosomal localization of the corresponding gene by in situ hybridization. The results show that this gene, a form of which is amplified in some poorly differentiated stomach cancers, is localized on chromosome region 10q26. The two previously identified fibroblast growth factor receptor genes are thus not on the same chromosome, as the related flg ("fms-like gene") fibroblast growth factor receptor gene has previously been mapped to human chromosome region 8p12.

Autoradiography↗
PubMed1991

A new human hypervariable locus (K29) maps to the q37.3 region of chromosome 2 and reveals a fingerprint.

A human genomic library was screened with a 30-base oligomer corresponding to the 5' end of the human calretinin cDNA. A clone that contains a minisatellite composed of 21 imperfect repeats of a 37-bp sequence was isolated. The consensus (GAGGGAGGAACTGGGACGCGTGCATGTTTGCATTCTC) incidentally shares 14 consecutive matches with the oligomer used as a probe, and it was shown that the clone did not belong to the calretinin locus. The minisatellite, named K29, was used as a probe on Southern blots at high stringency. After HaeIII, MboI, or HinfI digestion, it detected a single hypervariable locus, with 65% heterozygosity among Caucasian individuals. The probe used at low stringency revealed a fingerprint, with an average of four bands in addition to the locus-specific pattern. Mendelian inheritance was assessed on pedigrees. The K29 minisatellite was mapped by in situ hybridization to the very end of the long arm of chromosome 2 (2q37.3 band), at close proximity of the Fra2J locus, and is referred to as the D2S88 locus in the genome database.

Base Sequence↗
PubMed1991

Chromosomal assignments of the genes for neuroendocrine convertase PC1 (NEC1) to human 5q15-21, neuroendocrine convertase PC2 (NEC2) to human 20p11.1-11.2, and furin (mouse 7[D1-E2] region).

The chromosomal localization of the genes coding for the pro-protein and pro-hormone convertases PC1, PC2, and Furin has been achieved by in situ hybridization. The genes for PC1 and PC2 were located on human chromosomes 5q15-21 and 20p11.1-11.2, respectively. The gene for Furin was assigned to the mouse chromosome 7D1-7E2 region. These data complete the chromosomal localization of these three convertases in both human and mouse. The results confirm the regional correspondence of the human chromosomes 15 and mouse chromosomes 7, as well as between human chromosome 20 and mouse chromosome 2. Furthermore, the identification of the NEC1 locus on human chromosome 5 and mouse chromosome 13 suggests a conservation of synthenic regions between these regions of the human and mouse genomes.

Animals↗
PubMed1991

Chromosomal mapping of A1 and A2 adenosine receptors, VIP receptor, and a new subtype of serotonin receptor.

cDNA clones encoding four new receptors of the G-protein-coupled receptor family were obtained by selective amplification and cloning from thyroid cDNA and termed RDC1, RDC4, RDC7, and RDC8. RDC7 and RDC8 have recently been identified as A1 and A2 adenosine receptors, respectively. These cDNAs were utilized for chromosomal in situ hybridization to establish the genomic location of the corresponding genes in man. The results indicate that human RDC1, RDC4, RDC7, and RDC8 are in regions 2q37, 1p34.3-1p36.3, 22q11.2-22q13.1, and 11q11-11q13, respectively.

Chromosome Banding↗