PubMed1990
DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.