Biomedical subjects

M Chorazy

Publications and source records attributed to M Chorazy.

At least 19 recordsLinked to original sources

PubMed2004

Polymorphisms in TDG and MGMT genes - epidemiological and functional study in lung cancer patients from Poland.

Functional genetic polymorphisms of DNA repair genes are good candidates for cancer susceptibility markers. We studied two genes coding for proteins removing small DNA adducts by direct repair (MGMT), or mispaired DNA bases by base excision repair (TDG). The non-silent polymorphisms of MGMT (84:Phe, 143:Val, 178:Arg) and TDG (199:Ser, 367:Met), and the functional MGMT enhancer polymorphism, did not show any statistically significant association with lung cancer risk in our case-control analysis, but due to the relatively small number of individuals, strong conclusions on cancer risk association or lack thereof cannot be made. Sequencing of the TDG cDNA has not revealed any novel polymorphism, but did find an alternatively spliced mRNA missing exon 2. Our search for polymorphisms within the promoter-enhancer region of MGMT revealed three novel sequence variants. The functional significance of the previously published MGMT enhancer polymorphism (1099C->T) was assessed. The less frequent sequence variant of the enhancer was associated with a modest (16-64%), but statistically significant, increase of MGMT promoter-enhancer activity in the studied cell lines. This work points to the importance of studying the expression-regulating elements of genes, as they may contain functional polymorphisms with the potential for modulating risk of various diseases, including cancer.

Adult↗

PubMed2002

Taurine chloramine modulates cytokine production by human peripheral blood mononuclear cells.

The effect of taurine (Tau) and taurine chloramine (Tau-Cl) on the production of TNF- alpha, IL-1 beta, and IL-6 by peripheral blood mononuclear cells of healthy volunteers was examined. Cells were stimulated with bacterial lipopolysaccharide (LPS) in the presence of either Tau or Tau-Cl. After 24 h culture the cytokine concentrations were measured in both culture supernatants (secreted) and cell lysates (cell-associated) using ELISA. In LPS-stimulated cells Tau-Cl inhibited both the secreted and cell-associated IL-1 beta and IL-6, while exerted dual effect on TNF- alpha production: raising it slightly at low and reducing at higher concentration. By contrast, Tau had no significant effect on the cytokine production. These results indicate that Tau-Cl modulates synthesis of pro-inflammatory cytokines, and therefore it may play a role in the initiation and propagation of immune response.

Adult↗

PubMed2001

Genetic polymorphisms in DNA repair genes and risk of lung cancer.

Polymorphisms in DNA repair genes may be associated with differences in the repair efficiency of DNA damage and may influence an individual's risk of lung cancer. The frequencies of several amino acid substitutions in XRCC1 (Arg194Trp, Arg280His and Arg399Gln), XRCC3 (Thr241Met), XPD (Ile199Met, His201Tyr, Asp312Asn and Lys751Gln) and XPF (Pro379Ser) genes were studied in 96 non-small-cell lung cancer (NSCLC) cases and in 96 healthy controls matched for age, gender and cigarette smoking. The XPD codon 312 Asp/Asp genotype was found to have almost twice the risk of lung cancer when the Asp/Asn + Asn/Asn combined genotype served as reference [odds ratio (OR) 1.86, 95% confidence interval (CI), 1.02-3.40]. In light cigarette smokers (less than the median of 34.5 pack-years), the XPD codon 312 Asp/Asp genotype was more frequent among cases than in controls and was associated with an increased risk of NSCLC. Compared with the Asn/Asn carriers, the OR in light smokers with the Asp/Asn genotype was 1.70 (CI0.35 0.43-6.74) and the OR in those with the Asp/Asp genotype was 5.32 (CI0.35-21.02) (P trend = 0.01). The 312 Asp/Asp genotype was not associated with lung cancer risk in never-smokers or heavy smokers (>34.5 pack-years). The XPD-312Asp and -751Lys polymorphisms were in linkage disequilibrium in the group studied; this finding was further supported by pedigree analysis of four families from Utah. The XPD 312Asp amino acid is evolutionarily conserved and is located in the seven-motif helicase domain of the RecQ family of DNA helicases. Our results indicate that these polymorphisms in the XPD gene should be investigated further for the possible attenuation of DNA repair and apoptotic functions and that additional molecular epidemiological studies are warranted to extend these findings.

Adenosine Triphosphatases↗

PubMed2001

[Therapeutic drainage of abdominal cavity cyst performed under USG control -- the relations of its results and effectiveness].

278 patients with the cyst of pancreas, liver and kidneys diagnosed ultrasonographically have undergone the scintigraphic examination of their changes. In case of patients where transit of contents beyond the cyst limits has not been found, the results of volume obtained by 3 methods (the volume measured ultrasonographically volume drained and volume estimated by the method of radiomarker dilution) have been compared. The authors have proven that the best results have achieved in those patients where the drainage has been performed in the most accurate way. It means that the drained volume has been the closest to the actual volume which corresponds to that one achieved by the method of radiomarker dilution.

Cysts↗

PubMed2000

The effect of the genetic polymorphisms of CYP1A1,CYP2D6, GSTM1 and GSTP1 on aromatic DNA adduct levels in the population of healthy women.

Aromatic DNA adduct levels and polymorphisms of two phase I enzymes - CYP1A1 and CYP2D6 and two phase II enzymes - GSTM1 and GSTP1 were analyzed in a group of 133 nonsmoking healthy women 35-45 years old and holding jobs not connected with the exposure to the combustion products of organic matter. They were office workers from the south and north-eastern parts of Poland. Blood samples were collected in winter and in summer. Aromatic DNA adduct levels were measured in all winter and summer samples. The frequencies of CYP1A1, CYP2D6, GSTM1 and GSTP1 polymorphisms in samples from the studied women did not show any differences when compared with other Caucasian populations and the Polish male population studied previously. The differences in the levels of DNA adducts among the carriers of different genotypes were statistically non-significant. Analysis of combined genotypes selected the groups of volunteers with the highest and the lowest DNA adduct levels. The highest levels of DNA adducts were observed in the carriers of GSTM1(null)/CYP1A1Ile/Val (8.00+/-13.00 adducts/10(8) nucleotides in summer samples) and GSTP1-AA/CYP1A1Ile/Val genotypes (7.00+/-4.32 in winter and 7.30+/-7. 27/10(8) nucleotides in summer). The lowest levels of DNA adducts (3. 00+/-2.30 in winter and 2.00+/-3.16/10(8) nucleotides in summer) were found in the carriers of the genotype GSTP1-AG+GG/CYP1A1Ile/Val. The levels of DNA adducts in these groups were determined by the polymorphisms of GSTM1 and GSTP1 phase II detoxifying enzymes.

Adult↗

PubMed2000

Identification of four single nucleotide polymorphisms in DNA repair genes: XPA and XPB (ERCC3) in Polish population.

A deficiency in DNA repair is associated with increased cancer risk. Inter-individual variations in DNA repair capacity observed in humans may result from genetic polymorphisms in DNA repair genes. In order to provide a basis for future functional and molecular epidemiology studies on cancer susceptibility, we screened 35 individuals for polymorphisms in coding regions of XPA and XPB genes involved in nucleotide excision repair (NER). Relevant cDNA sequences were amplified by PCR, sequenced with fluorescently labeled terminators and analyzed with automated sequencer. Two polymorphisms in XPB were found: AAA-->AGA (445A>G; GenBank M31899) causing K117R substitution and GGC-->TGC (1299G>T; GenBank M31899) causing G402C exchange. Also, two polymorphisms in XPB were detected: CGA-->CAA (709G>A; GenBank D14533) causing R228Q exchange, and A-->G (23A>G; GenBank D14533) substitution in the 5' non-coding region of the gene. The three aforementioned amino acid substitutions were uncommon in this population (1.4%). In contrast, the substitution located 4 nucleotides upstream of the ATG start codon of XPB was frequent (57%). To our best knowledge this is the first report of these sequence variants. The location of these polymorphisms in evolutionary conserved regions suggest that they may be of functional significance.

Animals↗

PubMed2000

Polymorphisms of the GSTP1 and GSTM1 genes and PAH-DNA adducts in human mononuclear white blood cells.

Glutathione S-transferases (GSTs) are an important part of the protection system against a wide range of potentially harmful chemical compounds. GSTP1 and GSTM1 are mainly involved in detoxification reactions of PAH carcinogenic intermediates produced by cytochrome P450 (CYP). Polymorphism of the GST genes may influence the level of carcinogen-DNA adducts in human tissues and be associated with individual susceptibility to carcinogens. In this study, we examined the effect of common polymorphism in exon 5 (105Ile --> Val) of the GSTP1 gene, alone and in combination with GSTM1-deletion polymorphism, on the level of PAH-DNA adducts measured by (32)P-postlabeling assay in mononuclear white blood cells collected in winter and in summer from a total of 170 healthy volunteers. When GSTP1 genotypes alone were compared, no statistically significant differences in adduct levels were found. However, smokers with GSTM1(null)/GSTP1-AG or -GG combined genotype showed significantly higher adduct levels in summer than carriers of other GSTM1/GSTP1 combinations (5.60 +/- 5.10 vs. 3.45 +/- 4. 28/10(8) nucleotides, P = 0.015). Among smokers carrying GSTP1-AG or -GG genotype, individuals with GSTM1(null) genotype had a significantly higher level of adducts in summer than subjects with GSTM1(+) genotype (5.60 +/- 5.10 vs. 1.82 +/- 1.98/10(8), P = 0.002) and GSTM1(null)/GSTP1-AA genotype carriers (5.60 +/- 5.10 vs. 4.13 +/- 5.84/10(8), P = 0.03). When adduct levels measured either in winter or in the nonsmoker group were considered, no influence of GSTM1/GSTP1 genotypes was found. Our data show that the combined GSTM1 and GSTP1 genetic polymorphisms may modulate PAH-DNA adduct levels in mononuclear WBCs from individuals exposed to specific carcinogenic compounds, e.g., tobacco smoke, in relatively lower-exposure environmental conditions (i.e., in summer).

Adult↗

PubMed2000

[Efficacy of the impulse magnetic field therapy in patients after the outer drainage of abdominal cysts diagnosed with the use of isotopic and ultrasound techniques].

154 patients with pancreatic, renal or hepatic cysts have been treated with the outer drainage under USG monitoring. Because of cysts' contact with tracts penetrating to an organ or its lack, the patients have been divided into two groups. Directly after the puncture all the patients have undergone the high frequency impulse magnetic field therapy. A distinct, positive treatment effect has been found in patients who have gone through not only drainage, but also magnetic field.

Cysts↗

PubMed1999

Measurement of cytogenetic endpoints in women environmentally exposed to air pollution.

The levels of sister chromatid exchanges (SCE), high-frequency cells (HFC) and chromosomal aberrations (CA) were studied in lymphocytes of Silesian women environmentally exposed to ambient air pollutants. Inhabitants of a less polluted but similarly urbanized area, in a rural region of Poland, served as controls. The study population was selected to minimize the major confounding factors influencing SCE and CA. These factors include age, gender, smoking status, and occupation. All donors were 35-46 years old non-smoking City Hall clerks. The levels of all three biomarkers were significantly higher in the exposed group than in controls as analyzed by the Mann-Whitney U-test. No correlation was found between levels of CA and SCE. Additional possible confounders, such as passive smoking, ex-smoking and X-ray chest examination did not influence the levels of biomarkers. This study builds upon our previous research in a male population but better controls for confounders. Thus, the results reveal genetic damage resulting from low-dose but chronic environmental exposure.

Adult↗

PubMed1999

Novel genetic polymorphisms in DNA repair genes: O(6)-methylguanine-DNA methyltransferase (MGMT) and N-methylpurine-DNA glycosylase (MPG) in lung cancer patients from Poland.

Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non-small-cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC-->TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG-->CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59-bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance.

Carcinoma, Non-Small-Cell Lung↗

PubMed1999

Molecular epidemiological study of non-small-cell lung cancer from an environmentally polluted region of Poland.

The p53 mutation spectrum can generate hypotheses linking carcinogen exposure to human cancer. Although it is well-documented that tobacco smoking is a major cause of lung cancer, the contribution of air pollution is less well-established. We determined the molecular and immunohistochemical changes (p53 gene mutations, p53 protein accumulation and WAF1 protein expression) and genetic polymorphisms of GSTM1, CYP1A1 and CYP2D6 genes in a case series of non-small-cell lung cancers from Silesia. This region of southern Poland is highly industrialized with considerable environmental pollution. More than 50% of lung cancers (90/164) contained p53 mutations and 75% showed the combined alteration of the p53 gene and protein accumulation. Males occupationally exposed to coal-derived substances showed a relatively high frequency of squamous and large-cell carcinomas, relatively frequent mutations in codon 298 of p53 and a low frequency of p53 immunohistochemically positive tumours. Codon 298 GAG-->TAG mutations have rarely been found in lung cancers in other populations. We found no correlation between WAF1 protein expression and mutations in the p53 gene or p53 protein accumulation. No statistically significant relationship was found between p53 mutations and GSTM1, CYP1A1, CYP2D6 genotypes. Never smokers with lung cancers from Silesia had a higher frequency of G:C-->T:A transversions than previously reported of the p53 mutation spectrum in never smokers (6/15 vs 4/34; P = 0.06 by chi2). These data are a tentative indication that occupational and environmental exposure to polycyclic aromatic hydrocarbons, such as benzo(a)pyrene, in polluted air contributes to the molecular pathogenesis of lung cancer in never smokers.

Air Pollution↗

PubMed1999

GSTM1, GSTP1, CYP1A1 and CYP2D6 polymorphisms in lung cancer patients from an environmentally polluted region of Poland: correlation with lung DNA adduct levels.

The CYP and GST genetic polymorphisms, controlling metabolism of xenobiotics, are considered to influence an individual's susceptibility to environmental and occupational carcinogens and predisposition to cancer. In the study, the effect of the GSTM1, GSTP1, CYP1A1 and CYP2D6 polymorphisms was investigated in relation to PAH-DNA adduct levels in non-tumourous lung tissue from non-small cell lung cancer (NSCLC) patients living in the industrialized region of Upper Silesia, Poland. The level of adducts among smokers was significantly elevated when compared to non-smokers (P = 0.0005). Adduct levels correlated inversely with age of patients (P = 0.00001). The GSTP1 and CYP2D6 polymorphisms had no influence on DNA adduct levels. There was a significant relationship between high adduct levels and the combined GSTM1 (null)/CYP1A1-Ile/Val genotype in the squamous cell carcinoma group (P = 0.028). An elevated number of adducts was found in patients with the GSTM1 (null)/CYP1Al-Ile/Val genotype compared to the GSTM1 (null)/CYP1A1-Ile/Ile carriers (P = 0.043). A higher frequency of the CYP1A1-Ile/Val and GSTM1 (null)/CYP1A1-Ile/Val genotypes was observed in patients with high adduct levels (P = 0.05 and P = 0.009, respectively). A significant prevalence of the GSTM1(null)/CYP1A1-Ile/Val carriers in the adenocarcinoma group was found (P = 0.003). Thus, our findings imply that the GSTMI and CYP1A1 exon 7 polymorphisms may influence PAH-DNA adduct levels in target tissue from NSCLC patients, especially in the squamous cell carcinoma group. Moreover, individuals carrying the GSTM1(null)/CYP1A1-Ile/Val genotype might exhibit a greater predisposition to a peripheral type of lung cancer.

Adult↗

PubMed1999

[Individual predisposition to lung neoplasm--the role of genes involved in metabolism of carcinogens].

Molecular epidemiology of lung cancer analyses relationship between environment and individual susceptibility. Studying biomarkers of risk at the molecular level allows better understanding of chemical carcinogenesis processes and makes possible early detection of the disease as well as helps its prevention. Risk biomarkers include genetic polymorphism of CYP, GST and NAT genes that participate in metabolic biotransformation of various endo- and exogenous compounds including carcinogens. Exposure to potentially carcinogenic environmental factors plays an important role in etiology of lung cancer, which remains a leading cause of cancer death worldwide. This review presents current knowledge about molecular basis and impact of individual variations in carcinogen metabolism on lung cancer risk.

Biomarkers, Tumor↗

PubMed1998

Bleomycin sensitivity test in the exposed and reference human populations.

Sensitivity to bleomycin was investigated in lymphocytes collected from three groups of males: 30 occupationally exposed cokery workers, 38 environmentally exposed Silesian citizen and 35 rural inhabitants. The data were analyzed at both the individual and group levels. The first analysis has revealed a substantial interindividual variability in the level of generated breaks (breaks per cell, b/c). This variability was independent of the age of the donor, smoking habit and X-ray exposure as tested in the multiple regression model. The means per group for the occupationally and environmentally exposed persons were almost the same with the values of 0.674 and 0.639, respectively. These two groups differed significantly from the rural population (b/c=0.448, p<0.001 by MANOVA). The reproducibility of the assay was satisfying (p>0.49 by the Wilcoxon matched paired test) after omitting 7 out of 49 repeatedly sampled donors. Those persons exhibited extremely high b/c rates in the first sampling.

Adolescent↗

PubMed1998

Modulation of DNA adduct levels in human mononuclear white blood cells and granulocytes by CYP1A1 CYP2D6 and GSTM1 genetic polymorphisms.

The CYP1A1, CYP2D6 and GSTM1 genes encode biotransforming enzymes involved in activation and detoxification of xenobiotics. Metabolically activated chemical compounds may interact with DNA and form adducts. In this study, the effect of the GSTM1, CYP1A1 exon 7 and CYP2D6 polymorphisms on DNA adduct levels was studied in 170 healthy volunteers. DNA adducts levels were measured by 32P-postlabelling in mononuclear white blood cells (WBC, lymphocytes and monocytes) and granulocytes collected in summer and winter. The influence of the genotype on the level of DNA adducts in both types of WBCs was observed only in summer samples. Individuals with GSTM1 deficient (null) genotype had significantly elevated level of adducts in mononuclear WBCs (p = 0.045) and granulocytes (p = 0.031) compared to GSTM1 positives. Higher adduct levels in carriers of combined GSTM1(null)/CYP1A1-Ile/Val genotype were found in both types of WBCs when compared to GSTM1(+)/CYP1A1-Ile/Ile genotype carriers (p = 0.046 in granulocytes, p = 0.092 in mononuclear WBCs). CYP2D6 wild-type homozygotes (EMs) and heterozygotes (HEMs) were shown to have significantly higher mononuclear WBC DNA adduct levels than mutant homozygotes (PMs) (p = 0.037 and p = 0.014). When confounding factors associated with PAH exposure were taken into account a statistically significant effect of CYP1A1 exon 7 polymorphism on DNA adduct levels was found (p = 0.012 in mononuclear WBCs, p = 0.043 in granulocytes). In a subgroup of current smokers (n = 95) high DNA adduct levels in granulocytes were associated with GSTM1(null) genotype, and increased adduct levels in mononuclear WBCs correlated with CYP2D6 EM and HEM genotypes. In winter samples the association between the genotype and DNA adduct levels was not observed.

Adult↗

PubMed1998

A molecular epidemiology study in women from Upper Silesia, Poland.

The present report is a follow-up to our previous molecular epidemiology studies on DNA damage in residents of the industrial region of Upper Silesia. The study was designed to focus on environmental exposure to airborne pollutants; other exposures or confounding factors (e.g. smoking status and age) were eliminated. A Silesian population consisting of 67 donors was compared to 72 inhabitants of a less polluted but similarly urbanized area, surrounded by a rural part of Poland. In both regions the donors were non-smoking females with similar age range, and occupation. Eight biomarkers including urinary mutagenicity and 1-hydroxypyrene, polycylic aromatic hydrocarbon PAH-DNA adducts in oral mucosa, sister chromatid exchanges (SCE), high frequency cells (HFC), chromosomal aberrations (CA), and sensitivity to bleomycin in lymphocytes as well as glutathione s-transferase (GSTM1)/cytochrome P4501A1 (CYP1A1) genotypes were evaluated in samples collected in summer and winter seasons. All the biomarkers of internal and biological doses of mutagens and their early biologic effects indicated statistically significant increases in the Silesian group when compared to the controls. Immunohistochemical quantitation of PAH-DNA adducts additionally revealed significant seasonal changes in the levels of adducts. No influence of susceptibility genotypes (GSTM1 and CYP1A1) on biomarker levels was observed.

Adult↗

PubMed1997

Sister chromatid exchanges and high-frequency cells in men environmentally and occupationally exposed to ambient air pollutants: an intergroup comparison with respect to seasonal changes and smoking habit.

Sister chromatid exchanges (SCE) and high-frequency cells (HFC) were measured in peripheral blood lymphocytes from men environmentally and occupationally exposed to a mixture of ambient air pollutants. The environmentally exposed individuals were inhabitants of the industrial region of Upper Silesia; those occupationally exposed were Silesian cokery or steel plant workers, while the control group consisted of rural region residents. A total of 147 males were enrolled in the study. Blood samples were collected in winter (February) and summer (September) seasons. Three major areas were investigated during the study: exposure-based dose dependency, seasonal changes, and influence of smoking habits on the SCE frequencies. The latter is frequently reported as a confounding factor in SCE analyses. In both winter and summer samples, statistically significant increases of SCE were observed in the environmentally and occupationally exposed groups compared to the controls (p < 0.001). The difference between both exposed groups was also significant (p < 0.001). An intergroup comparison was based on ANOVA after adjustment for smoking status. In all three groups of interest, a seasonal variation was found with higher levels in winter. However, in a part of the study in which each donor served as his own control, statistical differences were only found within the exposed groups. Control region inhabitants did not have significantly higher frequencies of SCE in winter, compared to summer samples. The impact of two major confounders, age of the donor and smoking habit, was investigated by multiple regression analysis. Smoking was a major factor influencing the level of SCE. Nevertheless, the effect was seen in winter samples only, which suggests an additive response and adds new information to this known effect.

Adolescent↗

PubMed1997

Benzo(a)pyrene-albumin adducts in humans exposed to polycyclic aromatic hydrocarbons in an industrial area of Poland.

OBJECTIVES: The interaction of benzo(a)pyrene with serum albumin was measured in an attempt to identify the actual exposure and to evaluate albumin adduct measurements as biomarkers for exposure monitoring. METHODS: Benzo(a)pyrene-diol-epoxide (BPDE)-albumin adducts were measured by competitive enzyme linked immunosorbent assay (ELISA) in plasma of coke oven plant workers from three plants and from people living in a highly industrialised area of Silesia in Poland. Due to the high air concentrations of polycyclic aromatic hydrocarbons (PAHs) in this area, a control group was selected from a rural non-industrialised area in Poland. Breathing zone air measurements of PAHs were collected from some of the participants. RESULTS: Coke oven plant workers and non-occupationally exposed people had similar concentrations of albumin adducts whereas the rural controls were significantly lower (2.74 fmol adducts/microgram albumin (SEM 0.124)). The mean concentration of BPDE-albumin adduct in plasma of both the occupational and the environmental groups were significantly higher in the summer samples (4.34 fmol adducts/microgram albumin (SEM 0.335) and 4.55 fmol adducts/microgram albumin (SEM 0.296), respectively) than in the winter samples (3.06 fmol adducts/microgram albumin (SEM 0.187) and 3.04 fmol adducts/microgram albumin (SEM 0.184), respectively) even though the air measurements showed higher concentrations of PAHs in the winter. The statistical analysis did not show any effects of air exposures on concentrations of BPDE-albumin adduct. CONCLUSIONS: A multiple regression analysis of the measured concentrations of BPDE-albumin adducts for all the groups, during both seasons, indicates that occupational exposures do not contribute significantly to the formation of adducts. In general, the concentrations of albumin adducts found vary within relatively small limits for the two seasons and between the various groups of participants. No extreme differences were found.

Adolescent↗