Search PubMed⌕ Search

Biomedical subjects

M C Lara

Publications and source records attributed to M C Lara.

8 recordsLinked to original sources
PubMed2006

Infusion of platelets transiently reduces nucleoside overload in MNGIE.

Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is caused by thymidine phosphorylase (TP) deficiency, which leads to toxic accumulations of thymidine (dThd) and deoxyuridine (dUrd). In this work, we report that infusion of platelets from healthy donors to patients with MNGIE restored transiently circulating TP and reduced plasma dThd and dUrd levels, suggesting that treatments to achieve permanent restoration of circulating TP such as allogeneic stem cell transplantation or gene transfer might be therapeutic.

Adolescent↗
PubMed2005

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Blotting, Southern↗
PubMed2001

Acoustic divergence in two cryptic Hipposideros species: a role for social selection?

We present evidence that a relatively widespread and common bat from South East Asia comprises two morphologically cryptic but acoustically divergent species. A population of the bicoloured leaf-nosed bat (Hipposideros bicolor) from Peninsular Malaysia exhibits a bimodal distribution of echolocation call frequencies, with peaks in the frequency of maximum energy at ca. 131 and 142 kHz. The two phonic types are genetically distinct, with a cytochrome b sequence divergence of just under 7%. We consider the mechanisms by which acoustic divergence in these species might arise. Differences in call frequency are not likely to effect resource partitioning by detectable prey size or functional range. However, ecological segregation may be achieved by differences in microhabitat use; the 131kHz H. bicolor is characterized by significantly longer forearms, lower wing loading, a lower aspect ratio and a more rounded wingtip, features that are associated with greater manoeuvrability in flight that may enable it to forage in more cluttered environments relative to the 142 kHz phonic type. We suggest that acoustic divergence in these species is a consequence of social selection for a clear communication channel, which is mediated by the close link between the acoustic signal and receptor systems imposed by the highly specialized nature of the hipposiderid and rhinolophid echolocation system.

Animals↗
PubMed1996

The simultaneous diversification of South American echimyid rodents (Hystricognathi) based on complete cytochrome b sequences.

Variation in the complete nucleotide sequence of the mitochondrial cytochrome b gene was examined for 32 individuals representing 12 supraspecific taxa of South American rodents of the family Echimyidae (Hystricognathi). Representative genera of four other New World hystricognath families, the Old World porcupine Hystrix, and the myomorph murid rodents Rattus and Mus were used as outgroups in phylogenetic reconstructions. Monopoly of the family Echimyidae is strongly supported, a result fully consistent with existing morphological and paleontological data relative to the taxa examined. However, relationships among most supraspecific taxa within the family are poorly resolved. Poor resolution appears not to result from lack of data, but to a rapid, nearly simultaneous divergence of most Recent taxa. Generic groupings that are moderately to strongly supported include the tree rats of the Brazilian Atlantic Forest (Nelomys) and Amazonia (Echimys, Makalata) and the Amazonian arboreal spiny rats Mesomys and Lonchothrix. However, the two subgenera of the terrestrial spiny rats, Proechimys, do not form a monophyletic unit, and elevation of the Atlantic Forest Trinomys to generic status is supported. The genus Hoplomys is closely related to Proechimys (sensu stricto), a finding supported by other molecular data.

Animals↗
PubMed1990

On informed consent.

The question of whether patients should influence medical decisions, and if so how much, is not simple. Among other things, it is necessary to decide whether the patient's well-being should take precedence over respect for the patient's autonomy, or vice versa; whether or not the patient has the capacity to exercise true autonomy; what information should be furnished in order to provide the patient with the basis for making a decision about treatment; and how such information should be provided. This article examines these matters, reviews the pros and cons of various methods for obtaining patients' informed consent, presents some broad guidelines for dealing with informed consent issues in a therapeutic setting, and discusses ethical principles that should be applied in obtaining patients' informed consent to participate in clinical research.

Clinical Trials as Topic↗
PubMedDate not supplied

[The informed consent].

To what extent can or should a patient influence medical decisions? For a valid decision to be made, it is usually considered essential that the patient be autonomous and competent. If a person is not incapacitated for autonomous action, he can accept or reject a medical intervention on the basis of the information available to him. This raises the question of what the patient is to be told. The answer rests on which value is considered fundamental in medical practice: the patient's well-being or respect for his status as a person. This controversy arises in both the strictly therapeutic and the research contexts. In both cases, information must be explicit and clear. Many printed forms are hard to understand; the patient's signature merely precludes the possibility of legal problems. Depending on the kind of disease and treatment, the patient's consent may at times be almost tacit while at other times it should be based on complete information, especially if his decision seems irrational or contrary to the physician's judgment. In clinical trials, information and consent problems usually relate to the possibility that information given the participant will invalidate the findings. Nevertheless, the patient's rights and well-being should always be considered more important than the research.

Human Experimentation↗