Biomedical subjects

M A Taubman

Publications and source records attributed to M A Taubman.

At least 19 recordsLinked to original sources

PubMed2006

Immunogenic and protective potential of mutans streptococcal glucosyltransferase peptide constructs selected by major histocompatibility complex class II allele binding.

Mutans streptococcal glucosyltransferases (GTF) have been demonstrated to be effective components of dental caries vaccines. We had previously selected peptide subunits of GTF for vaccine development based on putative functional significance and conservation of GTF primary structure among enzyme isoforms. In this study, 20 20-mer linear GTF peptides were synthesized, 17 identified on the basis of the highest potential major histocompatibility complex (MHC) class II-binding activity using computer-generated algorithms (Epimatrix and ProPred) and 3 with previously demonstrated functional significance. The immunoreactivities of these peptides were explored with rodent systems. Sera from GTF-immunized rats, assessed for binding to linear peptides by enzyme-linked immunosorbent assay, demonstrated immunoglobulin G antibody reactivity with peptides 6 and 11 and a T-cell proliferation response to peptides 6, 9, 11, and 16. Multiple antigenic peptide (MAP) constructs were synthesized from promising linear sequences. Rats that were immunized with MAP 7, 11, or 16, respectively, responded well to the immunizing MAP. Most importantly, a robust immune response (antibody and T-cell proliferation) was observed to native GTF following MAP 11 (amino acids 847 to 866; VVINNDKFVSWGITDFEM) immunization. This response inhibited GTF enzyme function. Two dental caries pathogenesis experiments were performed wherein rats were immunized with MAP constructs 11, 16, and/or 11 plus 16, followed by infection with cariogenic Streptococcus sobrinus. In both experiments cariogenic bacterial recoveries were reduced relative to total streptococci in the MAP 11- and MAP 11 plus 16-immunized groups, and the extent of dental caries was also significantly reduced in these groups. Thus, we have identified a peptide with projected avid MHC-binding activity that elicited immunoreactivity with native GTF and demonstrated protection against dental caries infection after immunization, implying that this peptide may be important in a subunit dental caries vaccine.

Animals↗

PubMed2006

Innate immune peptide LL-37 displays distinct expression pattern from beta-defensins in inflamed gingival tissue.

Anti-microbial peptides produced from mucosal epithelium appear to play pivotal roles in the host innate immune defence system in the oral cavity. In particular, human beta-defensins (hBDs) and the cathelicidin-type anti-microbial peptide, LL-37, were reported to kill periodontal disease-associated bacteria. In contrast to well-studied hBDs, little is known about the expression profiles of LL-37 in gingival tissue. In this study, the anti-microbial peptides expressed in gingival tissue were analysed using immunohistochemistry and enxyme-linked immunosorbent assay (ELISA). Immunohistochemistry revealed that neutrophils expressed only LL-37, but not hBD-2 or hBD-3, and that such expression was prominent in the inflammatory lesions when compared to healthy gingivae which showed very few or no LL-37 expressing neutrophils. Gingival epithelial cells (GEC), however, expressed all three examined anti-microbial peptides, irrespective of the presence or absence of inflammation. Moreover, as determined by ELISA, the concentration of LL-37 in the gingival tissue homogenates determined was correlated positively with the depth of the gingival crevice. Stimulation with periodontal bacteria in vitro induced both hBD-2 and LL-37 expressions by GEC, whereas peripheral blood neutrophils produced only LL-37 production, but not hBD-2, in response to the bacterial stimulation. These findings suggest that LL-37 displays distinct expression patterns from those of hBDs in gingival tissue.

Adult↗

PubMed2006

Effect of adoptive transfer of antigen-specific B cells on periodontal bone resorption.

BACKGROUND AND OBJECTIVES: Host immune responses to periodontal pathogens have been considered to contribute to the alveolar bone destruction in periodontitis. However, the role of B lymphocytes in the pathogenesis of periodontal bone loss is not clear. METHODS: We examined the effect of adoptive transfer of antigen-specific B cells from rat spleens on experimental periodontal bone resorption. Donor rats were immunized intraperitoneally (i.p.) with formalin-killed Actinobacillus actinomycetemcomitans. Antigen-specific B cells were prepared from splenocytes by first binding CD43(+) cells to Petri dishes coated with anti-CD43 antibody to remove T cells, and non-binding cells were passed through a nylon wool column to deplete accessory cells. The retained cells were then collected and bound to A. actinomycetemcomitans-coated Petri dishes for enrichment of A. actinomycetemcomitans-binding B cells (AAB). A. actinomycetemcomitans non-binding B cells (ANB) and B cells from non-immunized donor rats (NIB) were also collected from these procedures. Each type of B cell was injected into a group of recipient rats that were then orally infected with live A. actinomycetemcomitans. RESULTS: At termination, the antibody levels to A. actinomycetemcomitans in serum and gingival wash fluids were significantly higher in the recipients transferred with AAB when compared to the recipients transferred with ANB or NIB. A markedly elevated number of antibody-forming cells were observed in the spleens of the recipients transferred with AAB, and these recipient rats also exhibited significantly increased bone resorption when compared to the other groups. CONCLUSIONS: It is suggested that B cells can contribute to periodontal bone resorption and that antigen-triggering of B cells is required for the bone resorption.

Actinobacillus Infections↗

PubMed2005

Influence of microparticle formulation on immunogenicity of SYI, a synthetic peptide derived from Streptococcus mutans GbpB.

Subcutaneous immunization with SYI, a peptide construct based on Streptococcus mutans glucan binding protein B (GbpB) residues 113-132, significantly reduces experimental dental caries. Since mucosal immunization may be preferred for human vaccine applications, the present objective was to determine what formulation of SYI combined with polylactide-coglycolide microparticles could give rise to significant levels of salivary IgA antibody reactive with the native GbpB protein. A comparison of the SYI construct, loaded into or mixed with polylactide-coglycolide revealed the SYI-loaded microparticles to induce significant and sustainable levels of salivary and nasal wash IgA antibody to the peptide and the native protein. SYI mixed with unloaded microparticles was less effective in mucosal antibody response induction. These studies indicate that mucosal immunization with the SYI construct can induce salivary IgA antibody to a pathogenesis-associated component of S. mutans if delivered within polylactide-coglycolide microparticles, suggesting that this approach could successfully induce protective salivary immunity to dental caries caused by S. mutans.

Animals↗

PubMed2005

Potassium channel-blockers as therapeutic agents to interfere with bone resorption of periodontal disease.

UNLABELLED: Inflammatory lesions of periodontal disease contain all the cellular components, including abundant activated/memory T- and B-cells, necessary to control immunological interactive networks and to accelerate bone resorption by RANKL-dependent and -independent mechanisms. Blockade of RANKL function has been shown to ameliorate periodontal bone resorption and other osteopenic disorders without affecting inflammation. Development of therapies aimed at decreasing the expression of RANKL and pro-inflammatory cytokines by T-cells constitutes a promising strategy to ameliorate not only bone resorption, but also inflammation. Several reports have demonstrated that the potassium channels Kv1.3 and IKCa1, through the use of selective blockers, play important roles in T-cell-mediated events, including T-cell proliferation and the production of pro-inflammatory cytokines. More recently, a potassium channel-blocker for Kv1.3 has been shown to down-regulate bone resorption by decreasing the ratio of RANKL-to-OPG expression by memory-activated T-cells. In this article, we first summarize the mechanisms by which chronically activated/memory T-cells, in concert with B-cells and macrophages, trigger inflammatory bone resorption. Then, we describe the main structural and functional characteristics of potassium channels Kv1.3 and IKCa1 in some of the cells implicated in periodontal disease progression. Finally, this review elucidates some recent advances in the use of potassium channel-blockers of Kv1.3 and IKCa1 to ameliorate the clinical signs or side-effects of several immunological disorders and to decrease inflammatory bone resorption in periodontal disease. ABBREVIATIONS: AICD, activation-induced cell death; APC, antigen-presenting cells; B(K), large conductance; CRAC, calcium release-activated calcium channels; DC, dendritic cell; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IFN-gamma, interferon-gamma; IP(3), inositol (1,4,5)-triphosphate; (K)ir, inward rectifier; JNK, c-Jun N-terminal kinase; I(K), intermediate conductance; LPS, lipopolysaccharide; L, ligand; MCSF, macrophage colony-stimulating factor; MHC, major histocompatibility complex; NFAT, nuclear factor of activated T-cells; RANK, receptor activator of nuclear factor-kappaB; T(CM), central memory T-cells; T(EM), effector memory T-cells; TNF, tumor necrosis factor; TRAIL, TNF-related apoptosis-inducing ligand; OPG, osteoprotegerin; Omp29, 29-kDa outer membrane protein; PKC, protein kinase C; PLC, phospholipase C; RT-PCR, reverse-transcriptase polymerase chain-reaction; S(K), small conductance; TCR, T-cell receptor; and (K)v, voltage-gated.

Alveolar Bone Loss↗

PubMed2003

Remote glucosyltransferase-microparticle vaccine delivery induces protective immunity in the oral cavity.

Intranasally administered dental caries vaccines show significant promise for human application. Alternate mucosal routes may be required, however, to induce caries-protective salivary IgA antibody in children with respiratory diseases. Since rectal mucosa contains inductive lymphoid tissue, we hypothesized that the rectal route could be used to induce salivary immunity to mutans streptococcal glucosyltransferase (GTF), resulting in protective immunity to experimental dental caries. We first explored the ability of glucosyltransferase, incorporated into polylactide-co-glycolide (PLGA) microparticles (MP), and administered rectally together with mucosal adjuvant, to induce a salivary IgA antibody response. Groups of Sprague-Dawley rats (6/group) were immunized rectally on days 0, 7, 14 and 21 with a) GTF-MP alone, b) GTF-MP with cholera toxin, c) GTF-MP with detoxified mutant Escherichia coli toxin (dLT), or d) sham immunized with PLGA and cholera toxin. An additional group was immunized intranasally with GTF-MP alone. Saliva and nasal washes of all intranasally immunized rats contained IgA antibody to glucosyltransferase on day 28. Salivary IgA antibody was also detected in 7/12 rats rectally immunized with GTF-MP and cholera toxin or dLT, although responses were lower than those obtained by intranasal immunization. Most fecal extracts from rectally delivered GTF-MP plus cholera toxin or dLT rats contained IgA antibody to GTF-MP. Low levels of fecal IgA antibody were detected in 3/6 intranasally immunized rats and 2/6 rats rectally immunized with GTF-MP alone. We then examined the extent to which salivary IgA antibody induced by the rectal route could be protective. At 25, 31 and 38 days of age, two groups of female Sprague-Dawley rats (13/group) were rectally immunized with GTF-MP and cholera toxin or with empty microparticles and cholera toxin (sham group). A third group was intranasally immunized with GTF-MP alone. After demonstrating salivary IgA responses to GTF in most GTF-immunized rats, all animals were infected with streptomycin-resistant Streptococcus sobrinus and placed on diet 2000. After 79 days of infection, total caries on molar surfaces were lower in both rectally (7.9 +/- 1.0) and intranasally (7.1 +/- 0.9; P < 0.0.03) immunized groups compared with the sham-immunized group (11.9 +/- 1.6). Smooth surface caries were significantly lower (P < 0.05) in both rectally and intranasally immunized groups. These results support the interconnectedness of the mucosal immune system and indicate that rectal immunization with GTF-MP, together with adjuvant, or intranasal immunization with GTF-MP alone, can induce protective levels of salivary antibody in rats.

Administration, Rectal↗

PubMed2001

Oligonucleotide containing CpG motifs enhances immune response to mucosally or systemically administered tetanus toxoid.

Oligodeoxynucleotides (ODN) containing unmethylated CpG dinucleotides induce proliferation of B cells and activation of macrophages and thus stimulation of the immune system. We tested an oligonucleotide containing an unmethylated CpG dinucleotide flanked by two 5' purines and two 3' pyrimidines (GAGAACGCTCGACCTTCGAT) for the ability to affect antibody levels to tetanus toxoid (Tt). Groups of male Rowett rats (n=5-6/group) received colloidal aluminium hydroxide (Al(OH)3) either alone, or with Tt bound to the Al(OH)3, or with Tt bound to Al(OH)3 with the addition of the CpG oligonucleotide. Antigens were administered subcutaneously in the salivary gland vicinity once, or by gastric intubation on 3 consecutive days. On day 124 all animals were given a boost with the same material by the same route. Serum IgG and saliva IgA antibody to Tt was determined by ELISA. Serum antibody levels were significantly higher in ODN+Tt treated rats than in Tt-alone rats immunized by either route after primary or booster immunizations. Thus, administration of an ODN containing unmethylated CpG motifs along with an immunogen bound to Al(OH)3 can result in enhanced specific antibody when administered by intragastric as well as subcutaneous routes.

Adjuvants, Immunologic↗

PubMed2001

Diepitopic construct of functionally and epitopically complementary peptides enhances immunogenicity, reactivity with glucosyltransferase, and protection from dental caries.

Coimmunization with peptide constructs from catalytic (CAT) and glucan-binding (GLU) domains of glucosyltransferase (GTF) of mutans streptococci has resulted in enhanced levels of antibody to the CAT construct and to GTF. We designed and synthesized a diepitopic construct (CAT-GLU) containing two copies of both CAT (B epitope only) and GLU (B and T epitope) peptides. The immunogenicity of this diepitopic construct was compared with that of individual CAT and GLU constructs by immunizing groups of Sprague-Dawley rats subcutaneously in the salivary gland vicinity with the CAT-GLU, CAT, or GLU construct or by treating rats by sham immunization. Levels of serum immunoglobulin G (IgG) antibody to GTF or CAT in the CAT-GLU group were significantly greater than in GLU- or CAT-immunized groups. Immunization with CAT-GLU was compared to coimmunization with a mixture of CAT and GLU in a second rodent experiment under a similar protocol. CAT-GLU immunization resulted in serum IgG and salivary IgA responses to GTF and CAT which were greater than after coimmunization. Immunization with the diepitopic construct and communization with CAT and GLU constructs showed proliferation of T lymphocytes to GTF. Immunization with either the CAT or GLU construct has been shown to elicit significant protection in a rodent dental caries model. Similarly in this study, the enhanced response to GTF after immunization with the CAT-GLU construct resulted in protective effects on dental caries. Therefore, the CAT-GLU diepitopic construct can be a potentially important antigen for a caries vaccine, giving rise to greater immune response than after immunization with CAT, GLU, or a mixture of the two.

Amino Acid Sequence↗

PubMed2001

Facilitated intranasal induction of mucosal and systemic immunity to mutans streptococcal glucosyltransferase peptide vaccines.

Synthetic peptide vaccines which are derived from functional domains of Streptococcus mutans glucosyltransferases (GTF) have been shown to induce protective immunity in Sprague-Dawley rats after subcutaneous injection in the salivary gland region. Since mucosal induction of salivary immunity would be preferable in humans, we explored methods to induce mucosal antibody in the rat to the GTF peptide vaccines HDS and HDS-GLU after intranasal administration. Several methods of facilitation of the immune response were studied: the incorporation of peptides in bioadhesive poly(D,L-lactide-coglycolide) (PLGA) microparticles, the use of monoepitopic (HDS) or diepitopic (HDS-GLU) peptide constructs, or the use of mucosal adjuvants. Salivary immunoglobulin A (IgA) responses were not detected after intranasal administration of diepitopic HDS-GLU peptide constructs in alum or after incorporation into PLGA microparticles. However, significant primary and secondary salivary IgA and serum IgG antibody responses to HDS were induced in all rats when cholera holotoxin (CT) or a detoxified mutant Escherichia coli heat-labile enterotoxin (R192G LT) were intranasally administered with HDS peptide constructs in PLGA. Coadministration of LT with HDS resulted in predominantly IgG2a responses in the serum, while coadministration with CT resulted in significant IgG1 and IgG2a responses to HDS. Serum IgG antibody, which was induced to the HDS peptide construct by coadministration with these adjuvants, also bound intact mutans streptococcal GTF in an enzyme-linked immunosorbent assay and inhibited its enzymatic activity. Thus, immune responses which are potentially protective for dental caries can be induced to peptide-based GTF vaccines after mucosal administration if combined with the CT or LT R192G mucosal adjuvant.

Adjuvants, Immunologic↗

PubMed2001

Involvement of T-lymphocytes in periodontal disease and in direct and indirect induction of bone resorption.

Periodontal disease is a peripheral infection involving species of gram-negative organisms. T-lymphocytes can be found in the dense inflammatory infiltrate in this disease. CD4+ and CD8+ T-cells are present in periodontal lesions, as are memory/activated T-lymphocytes. In addition, Th1- and Th2-type T-lymphocytes and their associated cytokines with a subtle polarization to Th1 may be present. Th1-type T-cells up-regulate the production of pro-inflammatory cytokines IL-1 and TNF-alpha, which can induce bone resorption indirectly by promoting differentiation of osteoclast precursors and subsequently by activating osteoclasts. Such osteoclast differentiation is dependent on stimulation of osteoprotegerin ligand (OPG-L) production by osteoblastic cells. By contrast, activated T-cells, by virtue of direct production and expression of OPG-L, can directly promote osteoclast differentiation. OPG-L appears to be predominantly expressed on Th1-type cells. The direct and indirect T-cell involvement in periodontal bone resorption appears to be dependent on the degree of Th1-type T-cell recruitment into inflamed gingival tissues. This T-cell recruitment is regulated by adhesion molecules and chemokines/chemokine receptors. The adhesion molecules involved include alpha4 and alpha6 integrins, LFA-1, and ICAM-1. The Th1-type T-cells preferentially express CCR5 and CXCR3, which are found prominently in diseased gingivae. By contrast, little CCR4, expressed by Th2-type T-cells, can be detected. Also, the chemokine ligands RANTES, MIP1-alpha (both CCR5), and IP-10 (CXCR3 ligand) were elevated in inflamed periodontal tissues. The T-cell features in diseased periodontal tissues can be compared with those in rheumatoid arthritis, wherein bone resorption often attributed to Th1-type T-cell involvement has also been demonstrated.

Alveolar Bone Loss↗

PubMed2000

Requirement of B7 costimulation for Th1-mediated inflammatory bone resorption in experimental periodontal disease.

The CD28 costimulation at TCR signaling plays a pivotal role in the regulation of the T cell response. To elucidate the role of T cells in periodontal disease, a system of cell transfer with TCR/CD28-dependent Th1 or Th2 clones was developed in rats. Gingival injection of specific Ag, Actinobacillus actinomycetemcomitans 29-kDa outer membrane protein, and LPS could induce local bone resorption 10 days after the transfer of Ag-specific Th1 clone cells, but not after transfer of Th2 clone cells. Interestingly, the presence of LPS was required not only for the induction of bone resorption but also for Ag-specific IgG2a production. LPS injection elicited the induction of expression of both B7-1 and B7-2 expression on gingival macrophages, which otherwise expressed only MHC class II when animals were injected with Ag alone. The expression of B7 molecules was observed for up to 3 days, which corresponded to the duration of retention of T clone cells in gingival tissues. Either local or systemic administration of CTLA4Ig, a functional antagonist of CD28 binding to B7, could abrogate the bone resorption induced by Th1 clone cells combined with gingival challenge with both Ag and LPS. These results suggest that local Ag-specific activation of Th1-type T cells by B7 costimulation appeared to trigger inflammatory bone resorption, whereas inhibition of B7 expression by CTLA4Ig might be a therapeutic approach for intervention with inflammatory bone resorption.

Abatacept↗

PubMed2000

Serum IgG reactivity to subgingival bacteria in initial periodontitis, gingivitis and healthy subjects.

BACKGROUND/AIMS: Established periodontal diseases may be associated with antibody responses to periodontal pathogens, but it is not known at which stage of disease this antibody response is initiated. This study aimed to characterize the host systemic response in initial periodontitis, gingivitis, and periodontal health, to evaluate whether elevated serum antibodies to subgingival species could be detected in initial periodontitis. METHOD: Human systemic immune response were evaluated to 40 subgingival bacterial species in 16 healthy, 21 gingivitis, 11 initial periodontitis and 5 progressing recession adults. Subjects had minimal periodontal attachment level (AL) loss at baseline. Disease categories were determined after 12 months monitoring at three-month intervals. Increased AL loss > or = 1.5 mm (disease activity) at interproximal sites defined initial periodontitis, recession was characterized by AL loss at buccal sites. Serum IgG antibodies were evaluated semi-quantitatively by immunoblot from blood taken at baseline, active and final visits. RESULTS: No antibody was detected from 55% of reactions. When detected, levels were below those reported for advanced periodontitis subjects. There were no major differences in serum antibody levels between healthy, gingivitis and initial periodontitis subjects, despite differences in the subgingival microbiota. Serum antibodies for more species were detected in recession subjects, compared with the other study subjects. No changes in antibody levels were detected between baseline, active, and final visits. No systematic association between species colonization and presence of systemic antibody was observed. CONCLUSIONS: This study did not detect differential elevation of mean serum antibody levels in initial periodontitis subjects, suggesting that serum antibody levels are not sensitive risk markers for initial periodontitis.

Adult↗

PubMed2000

T(h)1 transmigration anergy: a new concept of endothelial cell-T cell regulatory interaction.

Stimulation of endothelial cells (EC) with IFN-gamma generates selective enhancement of T(h)1 cell transmigration and induction of MHC class II expression on EC. In the present study, we tested whether antigen presentation by EC could influence transmigrating T cells in an in vitro system. Bacterial antigen presentation by EC from primary culture and after cloning induced antigen-specific anergy of transmigrating T(h)1 clone cells in a MHC class II-dependent manner as characterized by non-responsiveness to subsequent antigen presentation and inability to produce IL-2. This T cell transmigration anergy induced by EC was abrogated by anti-rat CD28 mAb, suggesting that lack of B7 co-stimulatory signals by EC might be related to the induction of anergy. While MHC class II expression on primary and cloned EC was observed after IFN-gamma stimulation, these cells never expressed B7. B7-1 gene-transfected endothelial clone cells (ECC/B7-1) were developed to elucidate the influence of B7 co-stimulation by EC. ECC/B7-1 induced proliferation of T(h)1 clone cells, whereas ECC did not induce proliferation in co-culture of T(h)1 clone cells and EC stimulated with IFN-gamma and antigen. In the transmigration assay, ECC/B7-1 did not induce transmigration anergy of T(h)1 clones or T(h)1 lines unless anti-rat B7-1 blocking mAb was added. Therefore, in rats, the T cell anergy induced during transmigration across a layer of EC seemed to be due to antigen presentation in the absence of B7 on the EC. We introduce the concept of transmigration anergy in this manuscript. Thus, EC can play a critical immune regulatory role in the context of antigen presentation by MHC class II to transmigrating T cells.

Animals↗

PubMed2000

Coimmunization with complementary glucosyltransferase peptides results in enhanced immunogenicity and protection against dental caries.

Peptide constructs from the catalytic (CAT) and glucan-binding (GLU) regions of the mutans streptococcal glucosyltransferase enzymes (GTF) can provide immunity to dental caries infection. A strategy of coimmunization was tested to determine whether protection could be enhanced. Rats were immunized with one of the previously described peptide constructs from the CAT or GLU region of the GTF of mutans streptococci or coimmunized with a combination of these constructs (CAT-GLU). Coimmunized animals demonstrated significantly higher serum immunoglobulin G (IgG) and salivary IgA antibody levels to CAT or GTF than rats immunized with either construct alone. To assess the functional significance of coimmunization with these constructs, animals were immunized as above or with Streptococcus sobrinus GTF and then infected with S. sobrinus to explore the effects of immunization on immunological, microbiological, and disease (dental caries) parameters. Serum antibody from the communized group inhibited S. sobrinus GTF-mediated insoluble glucan synthesis in vitro above that of the individual-construct-immunized groups. Immunization with CAT or GLU constructs resulted in significantly reduced dental caries after infection with S. sobrinus compared with sham-immunized animals. Coimmunization produced greater reductions in caries than after immunization with either CAT or GLU. Also, significant elevations in lymphocyte proliferative responses to CAT, GLU, and GTF were observed after coimmunization with CAT-GLU compared with the responses after immunization with the individual constructs. The results suggested that increased numbers of memory T cells, which could proliferate to CAT, were generated by coimmunization. The experiments support the functional significance of these GTF domains in dental caries pathogenesis and present coimmunization as a simple alternative to intact GTF to enhance protective immunity against cariogenic microorganisms.

Amino Acid Sequence↗

PubMed2000

Cytokine profiles of T-lymphocytes from gingival tissues with pathological pocketing.

Periodontal disease is an infection in which destruction occurs at sites remote from the infection, resulting in pathological pocketing. Intervening between the infection and the destruction is a dense mononuclear inflammatory infiltrate. It has been suggested that this infiltrate might have characteristics and the destructive potential of Th1-type T lymphocytes. To ascertain the nature of the infiltrates we investigated the expression of mRNA for IL-2, IL-5, and IFN-gamma by gingival mononuclear cells (GMC) from healthy (n = 8) or adult periodontitis (AP) patients (n = 25) by using cytokine-specific reverse-transcription/polymerase-chain-reaction (RT-PCR). GMC, as obtained from patients' tissues, expressed IL-2, IFN-gamma, or IL-5 mRNA. Significantly higher proportions of GMC from AP patients expressed IL-2 and IFN-gamma mRNA than did those from healthy subjects. IFN-gamma was the most consistent cytokine message detected. In other experiments, gingival T-lymphocytes (n = 12) and CD4+ and CD8+ gingival T-lymphocytes (n = 16) were isolated from gingival tissues removed surgically from AP patients. AP gingival T-lymphocytes expressed mRNA for IL-2, IFN-gamma, or IL-6 prior to stimulation. After stimulation with Con A, the cells significantly up-regulated IL-5 and IL-6 message expression. Both CD4+ and CD8+ gingival T-lymphocytes expressed IFN-gamma, IL-5, and some IL-2. This cumulative cytokine profile observed in these experiments is consistent with the predominance of Th1-type cells in pathological tissues and with Th2-type cells, which can also be present, being up-regulated under appropriate stimulation. Importantly, CD4+ and CD8+ lymphocytes were shown to express T1- and T2-type cytokine message, emphasizing the potential for CD8+ T-lymphocytes to participate in periodontal disease pathology.

Adolescent↗

PubMed1999

Selective diapedesis of Th1 cells induced by endothelial cell RANTES.

Differentiated CD4 T cells can be divided into Th1 and Th2 types based on the cytokines they produce. Differential expression of chemokine receptors on either the Th1-type or the Th2-type cell suggests that Th1-type and Th2-type cells differ not only in cytokine production but also in their migratory capacity. Stimulation of endothelial cells with IFN-gamma selectively enhanced transmigration of Th1-type cells, but not Th2-type cells, in a transendothelial migration assay. Enhanced transmigration of Th1-type cells was dependent on the chemokine RANTES produced by endothelial cells, as indicated by the findings that Ab neutralizing RANTES, or Ab to its receptor CCR5, inhibited transmigration. Neutralizing Ab to chemokines macrophage-inflammatory protein-1alpha or monocyte chemotactic protein-1 did not inhibit Th1 selective migration. Whereas anti-CD18 and anti-CD54 blocked basal levels of Th1-type cell adherence to endothelial cells and also inhibited transmigration, anti-RANTES blocked only transmigration, indicating that RANTES appeared to induce transmigration of adherent T cells. RANTES seemed to promote diapedesis of adherent Th1-type cells by augmenting pseudopod formation in conjunction with actin rearrangement by a pathway that was sensitive to the phosphoinositol 3-kinase inhibitor wortmannin and to the Rho GTP-binding protein inhibitor, epidermal cell differentiation inhibitor. Thus, enhancement of Th1-type selective migration appeared to be responsible for the diapedesis induced by interaction between CCR5 on Th1-type cells and RANTES produced by endothelial cells. Further evidence that CCR5 and RANTES play a modulatory role in Th1-type selective migration derives from the abrogation of this migration by anti-RANTES and anti-CCR5 Abs.

Actins↗

PubMed1999

Cloning of the gene encoding the Actinobacillus actinomycetemcomitans serotype b OmpA-like outer membrane protein.

The gene encoding an outer membrane protein A (OmpA)-like, heat-modifiable Omp of Actinobacillus actinomycetemcomitans ATCC 43718 (strain Y4, serotype b) was cloned by a PCR cloning procedure. DNA sequence analysis revealed that the gene encodes a protein of 346 amino acid residues with a molecular mass of 36.9 kDa. The protein expressed by the cloned gene reacted with a monoclonal antibody to the previously described 29-kDa Omp (Omp29) of strain Y4. This monoclonal antibody reacted specifically with Omp29 of A. actinomycetemcomitans (serotype b), but not with any Omp of Escherichia coli, including OmpA. This protein exhibited characteristic heat modifiability on sodium dodecyl sulfate-polyacrylamide gels, showing an apparent molecular mass of 29 kDa when unheated and a mass of 34 kDa when heated. The N-terminal amino acid sequence of the protein expressed in E. coli perfectly matched those deduced from the purified Omp29 of strain Y4. The deduced amino acid sequence of the gene coding for Omp29 from serotype b matched completely (except for valine at position 321) that of a recently reported omp34 gene described for A. actinomycetemcomitans serotype c (NCTC 9710). Because of the conserved nature of the gene within these serotypes, we designated the gene described herein from serotype b as omp34.

Aggregatibacter actinomycetemcomitans↗

PubMed1999

Antibody to glucosyltransferase induced by synthetic peptides associated with catalytic regions of alpha-amylases.

We examined the immunogenicity and induction of inhibitory activity of 19-mer synthetic peptides which contained putative catalytic regions that were associated with the beta5 (EAW) and beta7 (HDS) strand elements of the suggested (beta,alpha)8 catalytic barrel domain of Streptococcus mutans glucosyltransferase (GTF). Both peptides readily induced serum immunoglobulin G (IgG) and salivary IgA antipeptide activity which was reactive both with the inciting peptide and with intact S. mutans GTF. Antisera to each peptide construct also inhibited the ability of S. mutans GTF to synthesize glucan. These observations support the existence of catalytic subdomains containing glutamate and tryptophan (EAW) or aspartate and histidine (HDS) residues, each of which have been suggested to be involved with the catalytic activity of GTF. Furthermore, the epitopes defined in these sequences have significant immunogenicity and can induce immune responses which interfere with GTF-mediated glucan synthesis.

Amino Acid Sequence↗