Biomedical subjects

Lin Wang

Publications and source records attributed to Lin Wang.

At least 37 records · Page 2Linked to original sources

PubMed2006

Effect of an NK1/NK2 receptor antagonist on airway responses and inflammation to allergen in asthma.

RATIONALE: The tachykinins substance P and neurokinin A (NKA) are implicated in the pathophysiology of asthma. OBJECTIVE: We tested the safety, tolerability, and pharmacologic and biological efficacy of a tachykinin NK(1)/NK(2) receptor antagonist, AVE5883, in patients with asthma in two double-blind, placebo-controlled crossover studies. METHODS: The pharmacologic efficacy of a single inhaled dose (4.8 mg) of AVE5883 was tested against inhaled NKA in 20 patients with asthma. Subsequently, we studied the biological efficacy of the pharmacologically effective dose on inhaled allergen in a multiple-dose trial (4.8 mg three times per day, 9 d) in 12 patients with asthma with dual responses to inhaled house dust mite. On Day 8, an allergen challenge was conducted, and airway response was measured by FEV(1) until 9 hours postallergen. Exhaled NO, provocative concentration of methacholine bromide causing a 20% fall in FEV(1), and induced sputum were performed on Days 1, 7, and 9. RESULTS: AVE5883 had a bad taste, and transient bronchospasm occurred in some subjects. A single inhaled dose shifted the dose response to NKA by 1.2 doubling doses. Pretreatment with multiple doses of AVE5883 enhanced the allergen-induced early and late airway responses. There were no significant differences in the allergen-induced changes in exhaled NO, provocative concentration of methacholine bromide causing a 20% fall in FEV(1), and sputum cell differentials between placebo and AVE5883. CONCLUSIONS: Despite its demonstrated pharmacologic activity against inhaled NKA, multiple doses of AVE5883 increased the allergen-induced airway responses without affecting markers of airway hyperresponsiveness and airway inflammation. Our data question the prominent role of neurogenic inflammation in asthma and, consequently, the therapeutic potential of dual tachykinin antagonists.

Administration, Inhalation↗

PubMed2006

Molecular forms of trefoil factor 1 in normal gastric mucosa and its expression in normal and abnormal gastric tissues.

AIM: To study the molecular forms of trefoil factor 1 (TFF1) in normal gastric mucosa and its expression in normal and abnormal gastric tissues (gastric carcinoma, atypical hyperplasia and intestinalized gastric mucosa) and the role of TFF1 in the carcinogenesis and progression of gastric carcinoma and its molecular biological mechanism underlying gastric mucosa protection. METHODS: The molecular forms of TFF1 in normal gastric mucosa were observed by Western blot. The expression of TFF1 in normal and abnormal gastric tissues (gastric carcinoma, atypical hyperplasia and intestinalized gastric mucosa) was also assayed by immunohistochemical method. The average positive AO was estimated by Motic Images Advanced 3.0 software. RESULTS: Three patterns of TFF1 were found in normal gastric mucosa: monomer, dimmer, and TFF1 compound whose molecular weight is about 21 kDa. The concentration of TFF1 compound was the highest among these three patterns. TFF1 was expressed mainly in epithelial cytoplasm of the mucosa in gastric body and antrum, especially around the nuclei. The closer the TFF1 to the lumen, the higher the expression of TFF1. The expression of TFF1 in peripheral tissue of gastric carcinoma (0.51 +/- 0.07) was higher than that in normal gastric mucosa (0.44 +/- 0.06, P < 0.001). The expression of TFF1 in gastric adenocarcinoma was positively related to the differentiation of adenocarcinoma. The lower the differentiation of adenocarcinoma was, the weaker the expression of TFF1. No TFF1 was expressed in poorly-differentiated adenocarcinoma. The expression of TFF1 in moderately-well differentiated adenocarcinoma (0.45 +/- 0.07) was a little lower than that in normal mucosa (P > 0.05). The expression of TFF1 in gastric mucosa with atypical hyperplasia (0.57 +/- 0.03) was significantly higher than that in normal gastric mucosa (P < 0.001). No TFF1 was expressed in intestinalized gastric mucosa. There was no statistically significant difference between the expressions of TFF1 in gastric mucosa around the intestinalized tissue (0.45 +/- 0.07) and normal gastric mucosa (P > 0.05). CONCLUSION: TFF1 is expressed mainly in epithelial cytoplasm of the mucosa in gastric body and antrum. Its main pattern is TFF1 compound, which may have a greater biological activity than monomer and dimer. The expression of TFF1 in peripheral mucosa of gastric ulcer is higher than that in mucosa 5 cm beyond the ulcer, indicating that TFF1 plays an important part in protection and restitution of gastric mucosa. The expression of TFF1 is increased in peripheral tissues of gastric carcinoma and gastric mucosa with atypical hyperplasia, but is decreased in cancer tissues, implying that TFF1 may be related to suppression and differentiation of carcinoma. The weaker expression of TFF1 in poorly-differentiated carcinoma may be related to the destruction of glands and cells in cancer tissues and the decrease in secretion of TFF1.

Adult↗

PubMed2006

Spectroscopy and potential energy surface of the H2-CO2 van der Waals complex: experimental and theoretical studies.

A 4-D ab initio potential energy surface is calculated for the intermolecular interaction of hydrogen and carbon dioxide, using the CCSD(T) method with a large basis set. The surface has a global minimum with a well depth of 212 cm(-1) and an intermolecular distance of 2.98 A for a planar configuration with both the O-C-O and H-H axes perpendicular to the intermolecular axis. Bound state calculations are performed for the H(2)-CO(2) van der Waals complex with H(2) in both the para and ortho spin states, and the binding energy of paraH(2)-CO(2)(50.4 cm(-1)) is found to be significantly less than that of orthoH(2)-CO(2)(71.7 cm(-1)). The surface supports 7 bound intermolecular vibrational states for paraH(2)-CO(2) and 19 for orthoH(2)-CO(2), and the lower rotational levels with J< or = 4 follow an asymmetric rotor pattern. The calculated infrared spectrum of paraH(2)-CO(2) agrees well with experiment. For orthoH(2)-CO(2), the ground state rotational levels allowed by symmetry are found to have (K(a), K(c))=(even, odd) or (odd, even). This somewhat unexpected fact enables the previously observed experimental spectrum to be assigned for the first time, in good agreement with theory, and indicates that the orientation of hydrogen is perpendicular to the intermolecular axis in the ground state of the orthoH(2)-CO(2) complex.

Journal Article↗

PubMed2006

Preliminary studies of application of CdTe nanocrystals and dextran-Fe3O4 magnetic nanoparticles in sandwich immunoassay.

BACKGROUND: The favorable properties of water-soluble CdTe nanocrystals as novel biological luminescent label over conventional fluorescent probes have attracted considerable interest. The magnetic separation technique has widely been applied to various aspects in biotechnology in recent years. In this paper, we made use of CdTe nanocrystals and dextran-Fe3O4 magnetic nanoparticles for fluorescence immunoassay. METHODS: The CdTe nanocrystals and dextran-Fe3O4 magnetic nanoparticles were applied to immunoassay for the determination of human immunoglobulin G (HIgG). A rabbit anti-HIgG antibody (primary antibody) was immobilized on magnetic nanoparticles, which was used as a solid support. A sheep anti-HIgG antibody (secondary antibody) was attached to the surface of the CdTe nanocrystals via electrostatic interaction. The immunoassay was based on a sandwich immunoreaction of primary antibody on the magnetic nanoparticles, HIgG (or serum sample), and the secondary antibody labeled with CdTe nanocrystals. RESULTS: The CdTe label was compared with a fluorescein isothiocyanate (FITC) label. The CdTe is an order of magnitude more sensitive than the FITC. The immunoassay method was applied to determining the HIgG in practical samples and the results obtained are in good agreement with those obtained by nephelometry. CONCLUSION: This technique may be applied in many types of antibody-antigen system.

Animals↗

PubMed2006

CCR8 expression identifies CD4 memory T cells enriched for FOXP3+ regulatory and Th2 effector lymphocytes.

CD4+ Th2 cells are important regulators of allergic inflammation. CCR8 is thought to play a role in Th2-mediated responses, however, expression of CCR8 in peripheral blood has not been fully characterized. Using a fluorescent form of the ligand selective for CCR8 (F-CCL1), we identified the leukocytes expressing CCR8 in human, monkey, and mouse peripheral blood. CCR8 expression is primarily restricted to a subset of human CD4 memory T lymphocytes (15%). Approximately 40% of CCR8+CD4+ T cells express Th2 cytokines IL-4 or IL-13 while 13% express the Th1 cytokine IFN-gamma. In fact, 50% of all Th2, but only 5% of Th1, cells express CCR8. Upon anti-CD3/anti-CD28 mAb-mediated activation, CCR8+CD4+ T cells secrete 3- to 7-fold higher levels of IL-4, IL-5, IL-9, and IL-13 and 10- to 20-fold lower levels of IFN-gamma or IL-17, compared with CCR8-CD4+ memory T cells. Two-thirds of CCR8+CD4 T cells express cutaneous lymphocyte-associated Ag while the majority lack gut-homing receptors. CCR8+CD4+ cells express CCR7 and CD62L and are present in spleen and lymph nodes of mice. Approximately 25% of CCR8+CD4 T cells express CD25high while 20% of CCR8+CD4+ express the T regulatory cell transcription factor FOXP3 accounting for 60% of all FOXP3-expressing CD4+ T cells. In conclusion, CCR8 marks a diverse subset of CD4 memory T cells enriched for T regulatory and Th2 cells which have the potential for recruitment into sites of allergic inflammation where they could participate in the induction and regulation of the allergic response.

Animals↗

PubMed2006

Microspheres method for ocular blood flow measurement in rats: size and dose optimization.

This study modified the microspheres method by optimizing the dose and size of microspheres (MS) to enable accurate ocular blood flow measurement in rats. Fluorescent MS, either 6, 8, 10 or 15 microm diameter, were administered into the left ventricle of anesthetized adult Brown Norway rat in a dose of either 10(6), 5x10(6), or 10(7). The total number of MS entrapped in retina, choroid and optic nerve (Ntissue) was quantified and compared between size and dose groups. The MS distribution in the retina and their reentry into systemic circulation were evaluated for different sized MS. The results showed that at the 5x10(6) dose, the Ntissue of 8 microm MS was significantly more than either 6 or 10 microm MS in the retina (P<0.02) and optic nerve (P<0.03). The 10 microm MS produced the highest Ntissue for the choroid, as compared with either 8 or 6 microm MS (P<0.03). At the 10(6) dose, no difference of N(tissue) was found between 8, 10, and 15 microm MS in the retina. The 10 microm MS yielded the highest Ntissue in the choroid as compared to 8 and 15 microm MS (P<0.003). The Ntissue for 8 microm MS was higher than both 10 and 15 microm (P<0.01) MS in the optic nerve. No MS (>or=8 microm) reentered the systemic circulation. The 15 microm MS tended to lodge in pre-capillary arterioles and caused significant blood pressure increase during the injection. The blood flow measured with the optimal size MS (mean+/-SE) were 19+/-3.4 and 170+/-35 microl/min in the retina and choroid, respectively; and 0.18+/-0.03 microl/min per mm optic nerve. It is concluded that the 8 microm MS are the optimal size for both retinal and optic nerve blood flow estimation; the 10 microm for the choroid. The optimal dose for the retina was approximately 2.5x10(6), 0.5x10(6) for the choroid, and 5x10(6) approximately 10(7) for the optic nerve. The 15 microm MS are inappropriate for ocular blood flow measurements in rats.

Animals↗

PubMed2006

Coordinated effects of distal mutations on environmentally coupled tunneling in dihydrofolate reductase.

One of the most intriguing questions in modern enzymology is whether enzyme dynamics evolved to enhance the catalyzed chemical transformation. In this study, dihydrofolate reductase, a small monomeric protein that catalyzes a single C-H-C transfer, is used as a model system to address this question. Experimental and computational studies have proposed a dynamic network that includes two residues remote from the active site (G121 and M42). The current study compares the nature of the H-transfer step of the WT enzyme, two single mutants, and their double mutant. The contribution of quantum mechanical tunneling and enzyme dynamics to the H-transfer step was examined by determining intrinsic kinetic isotope effects, their temperature dependence, and activation parameters. Different patterns of environmentally coupled tunneling were found for these four enzymes. The findings indicate that the naturally evolved WT dihydrofolate reductase requires no donor-acceptor distance fluctuations (no gating). Both single mutations affect the rearrangement of the system before tunneling, so some gating is required, but the overall nature of the environmentally coupled tunneling appears similar to that of the WT enzyme. The double mutation, on the other hand, seems to cause a major change in the nature of H transfer, leading to poor reorganization and substantial gating. These findings support the suggestion that these distal residues synergistically affect the H transfer at the active site of the enzyme. This observation is in accordance with the notion that these remote residues are part of a dynamic network that is coupled to the catalyzed chemistry.

Escherichia coli↗

PubMed2006

Whole genome sequencing of a novel temperate bacteriophage of P. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome.

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5'-protruded cohesive ends and cohesive sequence is 'GCCGGCCCCTTTCCGCGTTA' (20 mer). There are four tRNA genes (tRNA(Asn), tRNA(Asp), tRNA(Tyr) and tRNA(Pro)) clustering at the 5'-terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC-21mer) locates at tRNA(Pro) gene within the attP region and at tRNA(Lys) gene in the attB region. The results indicated that 3'-end of tRNA(Pro) gene of the PaP3 genome is involved in the integration reaction and 5'-end of tRNA(Lys) gene of host bacteria genome is hot spot of the integration.

Chromosomes, Bacterial↗

PubMed2006

Structural and functional characterization of microcystin detoxification-related liver genes in a phytoplanktivorous fish, Nile tilapia (Oreochromis niloticus).

Liver genes related to phase I and phase II detoxification, as well as inhibition of reactive oxygen species (ROS) production, were cloned, and their response to microcystin-LR (MC-LR) and lipopolysaccharide (LPS) exposure via intraperitoneal injection, was determined in a phytoplanktivorous fish, Nile tilapia (Oreochromis niloticus). The cloned full-length cDNA of tilapia soluble glutathione S-transferase (sGST) was classified as alpha-class GST based on their amino acid sequence identity with other species. The tilapia sGST clone was 861 bp in length, and contained a 25 bp 5'-UTR, a 167 bp 3'-UTR and an open reading frame of 669 bp, encoding a polypeptide of 222 amino acids. Using genome walker method, a 366 bp 5'-flanking sequence of tilapia sGST gene was further obtained, and the possible regulatory elements were identified. Partial cDNA sequences of glutathione peroxidase (GPX) and uncoupling protein 2 (UCP2) were also obtained by PCR using degenerate primers from tilapia liver. To study the transcriptional response of liver genes to microcystin treatment, tilapia were respectively exposed to a single 50 microg kg(-1) body weight (bwt) dose of pure MC-LR, a single 2 mg kg(-1) bwt dose of LPS and a co-exposure MC-LR and LPS (50 microg kg(-1) bwt+2 mg kg(-1) bwt), and were then sacrificed at 24 h post-exposure. Using beta-actin as external control, a significant increase (about 80%) in sGST mRNA expression was found in response to the MC-LR exposure after 24 h (P < 0.05), indicating the importance of sGST in microcystin detoxification. A slight decrease of sGST mRNA expression was observed in the liver of tilapia, exposed to LPS and MC-LR+LPS. It seems that the LPS response element (LPSRE), identified in the promoter region of tilapia sGST gene, may be functional at a rather low level. In contrast, the levels of cytochrome P450 1A (CYP1A) mRNA expression were found to keep unchanged to either MC-LR, or LPS, or MC-LR+LPS treatment, indicating that unlike the phase II enzyme (sGST), the phase I enzyme (CYP1A) might not play an important role in the detoxification process of microcystins. Although not significant, the mRNA expression level of GPX tended to increase in the liver of tilapia exposed to both MC-LR and LPS (P > 0.05). In addition, a significant increase in UCP2 mRNA expression was observed in the liver of tilapia exposed to LPS (P < 0.05), as well as an obvious but not significant increase in MC-LR exposure group. We suggest that phase II detoxification enzyme, instead of phase I detoxification enzyme, might be responsible for the strong tolerance of the phytoplanktivorous fish to microcystins, and hepatocyte proteins coping with oxidative stress (GPX and UCP2), might also have some auxiliary effect. In addition, the rather low and insignificant response of tilapia sGST gene to the inhibitory effect of LPS exposure, might possibly be critical to the phytoplanktivorous fish to utilize toxic blue-green algae.

5' Flanking Region↗

PubMed2006

Kinetics and products of photolysis and reaction with OH radicals of a series of aromatic carbonyl compounds.

We have investigated the photolysis and OH radical reactions of phthaldialdehyde, 2-acetylbenzaldehyde, and 1,2diacetylbenzene, atmospheric reaction products of naphthalene and alkylnaphthalenes, and of phthalide, a photolysis product of phthaldialdehyde. Using a relative rate method with 1,2,4-trimethylbenzene and 2,2,3,3-tetramethylbutane as reference compounds, measured rate constants for the gas-phase OH radical reactions (in units of 10(-12) cm3 molecule(-1) s(-1)) were as follows: phthaldialdehyde, 23 +/- 3; 2-acetylbenzaldehyde, 17 +/- 3; 1,2-diacetylbenzene, < 1.2; and phthalide, < 0.8. Blacklamp irradiation showed that phthaldialdehyde and 2-acetylbenzaldehyde photolyze, and, combined with absorption spectra measured in n-hexane solution, average photolysis quantum yields of 0.19 and 0.21, respectively, were derived (290-400 nm). No evidence for photolysis of 1,2-diacetylbenzene or phthalide by blacklamps was obtained. The major atmospheric loss process of phthaldialdehyde and 2-acetylbenzaldehyde are estimated to be by photolysis, with photolysis lifetimes of 1.4-1.5 h for a 12-hr average NO2 photolysis rate of 0.312 min(-1). Phthalic anhydride was the major observed product from the OH radical-initiated reactions of all four compounds and was also formed from photolysis of phthaldialdehyde and 2-acetylbenzaldehyde. The major photolysis products observed were phthalide from phthaldialdehyde and 3-methylphthalide from 2-acetylbenzaldehyde.

Chromatography, Gas↗

PubMed2006

The role of enzyme dynamics and tunnelling in catalysing hydride transfer: studies of distal mutants of dihydrofolate reductase.

Residues M42 and G121 of Escherichia coli dihydrofolate reductase (ecDHFR) are on opposite sides of the catalytic centre (15 and 19 A away from it, respectively). Theoretical studies have suggested that these distal residues might be part of a dynamics network coupled to the reaction catalysed at the active site. The ecDHFR mutant G121V has been extensively studied and appeared to have a significant effect on rate, but only a mild effect on the nature of H-transfer. The present work examines the effect of M42W on the physical nature of the catalysed hydride transfer step. Intrinsic kinetic isotope effects (KIEs), their temperature dependence and activation parameters were studied. The findings presented here are in accordance with the environmentally coupled hydrogen tunnelling. In contrast to the wild-type (WT), fluctuations of the donor-acceptor distance were required, leading to a significant temperature dependence of KIEs and deflated intercepts. A comparison of M42W and G121V to the WT enzyme revealed that the reduced rates, the inflated primary KIEs and their temperature dependences resulted from an imperfect potential surface pre-arrangement relative to the WT enzyme. Apparently, the coupling of the enzyme's dynamics to the reaction coordinate was altered by the mutation, supporting the models in which dynamics of the whole protein is coupled to its catalysed chemistry.

Catalysis↗

PubMed2006

Effect of rare-earth component of the RE/Ni catalyst on the formation and nanostructure of single-walled carbon nanotubes.

A systematic experimental study has been carried out on the efficiency of bimetallic catalysts based on Ni and the rare-earth elements Y, La, Ce, Nd, Gd, Tb, Dy, Ho, Er, and Lu (group A) and Eu, Sm, Yb, and Tm (group B) in the synthesis of single-walled carbon nanotubes (SWNTs). The two groups give quite different results when analyzed by a combination of SEM/TEM and Raman and UV-NIR spectroscopies. The elements in group A have an obvious catalytic effect and increase the yield of SWNTs dramatically, whereas those in group B are not efficient catalysts. The diameter distribution of the synthesized SWNTs was also affected by the rare-earth element used. For group A metals, there is a tendency that the fraction of small-diameter tubes decreases with decreasing ionic radius of the rare-earth element used. EDX and X-ray analyses indicate that group A metals deposit on the cathode deposits and form rare-earth carbides, whereas no group B metals are found in cathode deposits, except for a small amount of Tm present in the form of thulium carbide. Further analysis indicates that there is a very strong correlation between the ability to form rare-earth carbides and the catalytic efficiency for the formation of SWNTs.

Journal Article↗

PubMed2006

Structural conservation and food habit-related liver expression of uncoupling protein 2 gene in five major Chinese carps.

The full-length cDNA of grass carp (Ctenopharyngodon idellus) and silver carp (Hypophthalmichthys molitrix) uncoupling protein 2 (UCP2) was obtained from liver. The grass carp UCP2 cDNA was determined to be 1152 bp in length with an open reading frame that encodes 310 amino acids. Five introns (Intron 3, 4, 5, 6 and 7) in the translated region, and partial sequence of Intron 2 in the untranslated region of grass carp UCP2 gene were also obtained. Gene structure comparison between grass carp and mammalian (human and mouse) UCP2 gene shows that, the UCP2 gene structure of grass carp is much similar to that of human and mouse. Partial UCP2 cDNA sequences of bighead carp (Aristichthys nobilis) and mud carp (Cirrhinus molitorella), were further determined. Together with the common carp (Cyprinus carpio) UCP2 sequence from GenBank (AJ243486), multiple alignment result shows that the nucleotide and amino acid sequences of the UCP2 gene, were highly conserved among the five major Chinese carps that belong to four subfamilies. Using beta-actin as control, the ratio UCP2/beta-actin mRNA (%) was determined to be 149.4 +/- 15.6 (common carp), 127.4 +/- 22.1(mud carp), 96.7 +/- 12.7 (silver carp), 94.1 +/- 26.8 (bighead carp) and 63.7 +/- 16.2 (grass carp). The relative liver UCP2 expression of the five major Chinese carps, shows a close relationship with their food habit: benthos and detritus-eating fish (common carp and mud carp) > planktivorious fish (silver carp and bighead carp) > herbivorous fish (grass carp). We suggest that liver UCP2 might be important for Chinese carps to detoxify cyanotoxins and bacteria in debris and plankton food.

Amino Acid Sequence↗

PubMed2006

An amphipathic helix targets serum and glucocorticoid-induced kinase 1 to the endoplasmic reticulum-associated ubiquitin-conjugation machinery.

Serum- and glucocorticoid-induced kinase 1 (Sgk1) regulates many ion channels and transporters in epithelial cells and promotes cell survival under stress conditions. In this study we demonstrate that Sgk1 is a short-lived protein regulated by the endoplasmic reticulum (ER)-associated degradation system and subcellular localization to the ER. We identified a hydrophobic motif (residues 18-30) as the signal for ER localization and rapid degradation by the ubiquitin (Ub)/proteasome pathway in both yeast and mammalian cells. Deletion or reduction of hydrophobicity of the motif redistributes Sgk1 to the cytosol and nucleus and markedly increases its half-life. We determined that the Ub-conjugating UBC6 and UBC7 and the Ub ligase HRD1 are the ER-associated Ub enzymes that mediate degradation of Sgk1; thus, Sgk1 has been identified as a cytosolic substrate for mammalian HRD1. Compartmentalization of Sgk1 controls the functional and spatial specificities of Sgk1-mediated signaling pathways, whereas rapid protein turnover provides a means to rapidly adjust Sgk1 abundance in response to different hormonal and external stimuli that increase Sgk1 gene transcription.

Animals↗

PubMed2006

Effects of gastric ischemia-reperfusion on gastric mucosal cellular apoptosis and proliferation in rats.

The effect of gastric ischemia-reperfusion (GI-R) on gastric mucosal cellular apoptosis and proliferation was investigated using histological, immunohistochemical methods in Sprague-Dawley rats. The GI-R model was established by clamping the celiac artery for 30 min and reperfusing for 0, 0.5, 1, 3, 6, 24, 48, 72 h, respectively. Mild gastric mucosal injury was induced by ischemia alone. However, the injury worsened and reached the maximum at 1 h after reperfusion, almost simultaneously with the gastric mucosal cellular apoptosis increase and cellular proliferation decrease in gastric mucosa. Then, gastric mucosal cells began to repair by increasing gastric cellular proliferation, which achieved the maximum at 24 h after reperfusion. The mucosal lesions were almost completely repaired at about 72 h after reperfusion. These results indicate that the gastric mucosal injury after GI-R is mainly induced by reperfusion. The damaged gastric mucosa could initiate its repairing mechanism immediately through inhibiting cellular apoptosis and increasing the number of proliferative cells, which substitute the damaged cells gradually. The plerosis almost completes in three days after reperfusion showing a strong self-repair ability of gastric mucosa.

Animals↗

PubMed2006

Angiogenesis enhances factor IX delivery and persistence from retrievable human bioengineered muscle implants.

Human muscle progenitor cells transduced with lentiviral vectors secreted high levels of blood clotting factor IX (FIX). When bioengineered into postmitotic myofibers as human bioartificial muscles (HBAMs) and subcutaneously implanted into immunodeficient mice, they secreted FIX into the circulation for >3 months. The HBAM-derived FIX was biologically active, consistent with the cells' ability to conduct the necessary posttranslational modifications. These bioengineered muscle implants are retrievable, an inherent safety feature that distinguishes this "reversible" gene therapy approach from most other gene therapy strategies. When myofibers were bioengineered from human myoblasts expressing FIX and vascular endothelial growth factor, circulating FIX levels were increased and maintained long term within the therapeutic range, consistent with the generation of a vascular network around the HBAM. The present study implicates an important role for angiogenesis in the efficient delivery of therapeutic proteins using tissue engineered stem cell-based gene therapies.

Animals↗

PubMed2006

Combination of laparoscopic and open procedure in dismembered pyeloplasty: report of 51 cases.

BACKGROUND: Laparoscopic dismembered pyeloplasty with less trauma than open surgery is commonly performed for ureteropelvic junction obstruction despite a longer operating time and a long learning curve. We describe in this paper a new technique, which combines laparoscopic and open procedure in dismembered pyeloplasty, that we have developed in 51 patients and achieved excellent results. METHODS: The surgical procedure can be divided into two steps: laparoscopic dissection of the renal pelvis and proximal ureter transperitoneally; then accomplishing the pyeloplasty through the extended port incision above the ureteropelvic junction as in open surgery. RESULTS: All 51 operations were successful without conversion to open surgery. No intraoperative complications were observed. The operating time was 40 minutes to 90 minutes with an average of 57.5 minutes. The estimated blood loss was 15 ml to 30 ml with an average of 21.2 ml. Aberrant artery vessel and primary stricture as the cause of ureteropelvic junction obstruction was noted in 2 and 49 patients, respectively. Thirty-nine patients had fever to differing extents in the 4 days postoperation and no severe infection was observed. Four patients had urinary leakage with their drains being retained for 6 days, 6 days, 5 days or 8 days after the operation. The mean followup was 10.8 months (range 3 months to 36 months). The followup showed good results with symptom resolution in all the patients. Renal ultrasonography demonstrated that the average separation of the collecting systems decreased from preoperative 2.7 cm (range 2.0 cm to 4.7 cm) to postoperative 1.5 cm (range 1.0 cm to 2.3 cm). Excretory urography at 3 months postoperatively showed improved drainage. Of the 51 patients, 35 underwent two or more excretory urograms, demonstrating stable renal function, improved drainage and no evidence of recurrent obstruction. At the last followup visit, each patient was doing well. CONCLUSIONS: Combination of laparoscopic and open procedure in dismembered pyeloplasty offers a simpler, timesaving method in a minimally invasive fashion with low morbidity for patients with ureteropelvic junction obstruction. Ensuring quality of repair, the method provides a minimally invasive alternative with good results. It is worth future clinical application.

Adolescent↗

PubMed2006

Prolylcarboxypeptidase gene, chronic hypertension, and risk of preeclampsia.

OBJECTIVE: Renin-angiotensin System is essential for the homeostasis of blood pressure in humans. The roles of renin-angiotensin system gene polymorphisms including angiotensinogen, angiotensin-converting enzyme, renin and angiotensin II receptor, type 1 genes in the pathogenesis of preeclampsia have been extensively studied, but most association studies produced either negative or inconsistent results. Prolylcarboxypeptidase encodes a lysosomal enzyme and is a regulator for both renin-angiotensin system and the kallikrein-kinin system. There is no published study on prolylcarboxypeptidase gene and preeclampsia. STUDY DESIGN: We investigated the independent and joint association of five polymorphisms in angiotensinogen, angiotensin-converting enzyme, and prolylcarboxypeptidase gene and chronic hypertension with the risk of preeclampsia in 125 preeclamptic and 1040 non-preeclamptic black women enrolled at the Boston Medical Center. We used logistic regression models to estimate the odds ratios of risk for preeclampsia associated with each gene polymorphism and its joint association with chronic hypertension. RESULTS: No association was found in four polymorphisms in angiotensinogen and angiotensin-converting enzyme. Prolylcarboxypeptidase E112D (rs2298668) D allele along and jointly with chronic hypertension were associated with a significantly increased risk of preeclampsia. Compared to women with homozygous EE genotype and without chronic hypertension, higher risks of preeclampsia were observed in DD women without chronic hypertension (OR = 3.7, 95% CI, 1.2 - 12.4) and EE women with chronic hypertension (OR = 9.1, 95% CI: 4.7 - 17.6). Women with both D allele and chronic hypertension had the highest risk (OR = 158, 95% CI, 25-infinite). This finding was validated in an independent sample of 1,015 non-black women. We further compared the prolylcarboxypeptidase transcript levels in peripheral blood cells of 23 preeclamptic (30% with chronic hypertension) and 51 non-preeclamptic (6% with chronic hypertension) women 2 - 3 days after delivery. The PRCP transcript levels were lower in ED/DD women than in EE woman (P = .03) and lower in preeclamptic women than in non-preeclamptic women (P = .007). CONCLUSION: Our data showed that prolylcarboxypeptidase D allele coupled with chronic hypertension was associated with a significantly increased risk of preeclampsia in both black and non-black women. Gene expression assays lent further support for the functional significance of prolylcarboxypeptidase in the etiology of preeclampsia.

Adult↗