Search PubMed⌕ Search

Biomedical subjects

L V Mendelman

Publications and source records attributed to L V Mendelman.

10 recordsLinked to original sources
PubMed2006

Uptake, metabolism, mutant frequencies and mutational spectra in lambda transgenic medaka embryos exposed to benzo[alpha]pyrene dosed sediments.

The goal of this study was to provide data supporting the use of lambda transgenic medaka (Oryzias latipes) embryos to evaluate mutagens in sediments. Embryos incubated directly on sediments dosed with the reference mutagen, benzo[alpha]pyrene (BaP), were examined for BaP uptake and metabolism. Mutant frequency and mutational spectrum were assessed in the cII transgene recovered from adult medaka livers exposed as embryos. Embryos rapidly accumulated 14C-BaP and metabolized BaP to polar metabolites, indicating sediment-sorbed BaP is available for bioaccumulation and medaka embryos are capable of bioactivating this mutagen. Exposure of embryos to BaP dosed sediments significantly induced cII transgene mutant frequencies with mutations predominantly being in G:C base pairs, consistent with known mechanisms of BaP mutagenesis in transgenic mice and fish.

Animals↗
PubMed1995

Effects of base analog substitutions in the noncoding dC of the 3'-d(CTG)-5' template recognition site of the bacteriophage T7 primase.

The 63-kDa gene 4 protein (DNA primase) of bacteriophage T7 catalyzes the synthesis of the oligoribonucleotides pppACC(C/A) and pppACAC at single-stranded DNA recognition sites 3'-d[CTGG-(G/T)]-5' and 3'-d(CTGTG)-5', respectively. At these sites, the 3'-terminal deoxycytidine residue is conserved but noncoding; the 3'-dC residue is required to initiate catalytic synthesis of oligoribonucleotides, yet it is not used as a template residue for the synthesis of a complementary G residue in the RNA primer. We have examined the interactions between T7 primase and the functional groups of the 3'-dC residue by measuring the ability of the primase to catalyze the synthesis of oligoribonucleotides on synthetic single-stranded 20-mer templates [e.g., 3'-d(GCTATGGTGACTGGTAGTCG)-5'] that contain analogs of dC in the conserved pentanucleotide recognition site. Recognition sites containing 5-methyldeoxycytidine (m5dC) or 1-(beta-D-2'-deoxyribosyl)-2-pyrimidinone (dH4C) substitutions for dC support oligoribonucleotide synthesis whereas those containing deoxythymidine (dT) and deoxyuridine (dU) substitutions do not. Oligoribonucleotide synthesis on the native template (containing dC) is inhibited competitively by the template containing a dT residue in the primase recognition site, 3'-[(N10)TTGGT(N5)]-5', with an apparent Ki of 1.30 +/- 0.04 microM. Templates containing dU residues, 3'-[(N10)UTGGT(N5)]-5' and 3'-[(N9)UTTGGT-(N5)]-5', affect both the apparent Km and Vmax parameters for oligoribonucleotide synthesis on the 3'-[(N10)CTGGT(N5)]-5' template.

Bacteriophage T7↗
PubMed1994

Requirement for a zinc motif for template recognition by the bacteriophage T7 primase.

Gene 4 of bacteriophage T7 encodes two proteins, a 63 kDa and a colinear 56 kDa protein. The coding sequence of the 56 kDa protein begins at the residues encoding an internal methionine located 64 amino acids from the N-terminus of the 63 kDa protein. The 56 kDa gene 4 protein is a helicase and the 63 kDa gene 4 protein is a helicase and a primase. The unique 7 kDa N-terminus of the 63 kDa gene 4 protein is essential for primer synthesis and contains sequences with homology to a Cys4 metal binding motif, Cys-X2-Cys-X17-Cys-X2-Cys. The zinc content of the 63 kDa gene 4 protein is 1.1 g-atom/mol protein, while the zinc content of the 56 kDa gene 4 protein is < 0.01, as determined by atomic absorption spectrometry. A bacteriophage deleted for gene 4, T7 delta 4-1, is incapable of growing on Escherichia coli strains that contain plasmids expressing gene 4 proteins with single amino acid substitutions of Ser at each of the four conserved Cys residues (efficiency of plating, 10(-7)). Primase containing a substitution of the third Cys for Ser has been overexpressed in E. coli and purified to homogeneity. This mutant primase cannot catalyze template-directed synthesis of oligoribonucleotides although it is able to catalyze the synthesis of random diribonucleotides in a template-independent fashion. The mutant primase has reduced helicase activity although it catalyzes single-stranded DNA-dependent hydrolysis of dTTP at rates comparable with wild type primase. The zinc content of the mutant primase is 0.5 g-atom/mol protein.

Amino Acid Sequence↗
PubMed1993

Evidence for distinct primase and helicase domains in the 63-kDa gene 4 protein of bacteriophage T7. Characterization of nucleotide binding site mutant.

Gene 4 of bacteriophage T7 encodes two co-linear proteins, the 56- and 63-kDa gene 4 proteins. The 56-kDa protein translocates 5' to 3' on single-stranded DNA using nucleotide hydrolysis for energy and is a helicase. The 63-kDa gene 4 protein catalyzes all of the activities of the 56-kDa gene 4 protein and, in addition, catalyzes the synthesis of oligoribonucleotides on single-stranded DNA. Two conserved residues in a putative nucleotide binding site of the 63-kDa gene 4 protein were mutated by substituting Val and Met for wild-type residues Gly and Lys, at positions 317 and 318, respectively. The mutant 63-kDa gene 4 protein lacks the ability to catalyze the hydrolysis of a nucleoside 5'-triphosphate in a single-stranded DNA-dependent reaction and inhibits nucleotide hydrolysis by wild-type gene 4 proteins. The mutant primase contains 0.4% of the primase activity of the 63-kDa gene 4 protein on M13 single-stranded DNA and 12% of the wild-type primase activity on an oligonucleotide with a single primase recognition site. Addition of wild-type 56-kDa gene 4 protein stimulates the mutant primase activity over 50-fold on M13 single-stranded DNA and 8-fold on oligonucleotides. This increase in primase activity correlates with an increase in the affinity of the mutant primase-wild-type helicase complex for single-stranded DNA template.

Bacteriophage T7↗
PubMed1992

Roles of bacteriophage T7 gene 4 proteins in providing primase and helicase functions in vivo.

The helicase and primase activities of bacteriophage T7 are distributed between the 56- and 63-kDa gene 4 proteins. The 56-kDa gene 4 protein lacks 63 amino acids found at the N terminus of the colinear 63-kDa protein and catalyzes helicase activity. The 63-kDa gene 4 protein catalyzes both primase and helicase activities. A bacteriophage deleted for gene 4, T7 delta 4-1, has been tested for growth by complementation on Escherichia coli strains that contain plasmids expressing either one or both of the gene 4 proteins. T7 delta 4-1 cannot grow (efficiency of plating, 10(-7)) on E. coli cells that express only 56-kDa gene 4 protein. In contrast, T7 delta 4-1 has an efficiency of plating of 0.1 on an E. coli strain that expresses only 63-kDa gene 4 protein in which glycine is substituted for methionine at position 64. A bacteriophage, T7 4B-, in which methionine at residue 64 is replaced by glycine, expresses only 63-kDa gene 4 protein. The burst sizes, latency periods, and Okazaki fragment sizes of T7 4B- are similar in the presence and absence of the 56-kDa gene 4 protein; however, T7 4B- has a reduced rate of DNA synthesis when compared with a phage that synthesizes both gene 4 proteins.

Amino Acid Sequence↗
PubMed1991

Requirements for primer synthesis by bacteriophage T7 63-kDa gene 4 protein. Roles of template sequence and T7 56-kDa gene 4 protein.

Gene 4 of bacteriophage T7 encodes two proteins, a 63-kDa protein and a colinear 56-kDa protein, that are essential for synthesis of leading and lagging strands during DNA replication. The gene 4 proteins together catalyze the synthesis of oligoribonucleotides, pppACC(C/A) or pppACAC, at the single-stranded DNA sequences 3'-CTGG(G/T)-5' or 3'-CTGTG-5', respectively. Purified 56-kDa protein has helicase activity, but no primase activity. In order to study 63-kDa gene 4 protein free of 56-kDa gene 4 protein, mutations were introduced into the internal ribosome-binding site responsible for the translation of the 56-kDa protein. The 63-kDa gene 4 protein was purified 16,000-fold from Escherichia coli cells harboring an expression vector containing the mutated gene 4. Purified 63-kDa gene 4 protein has primase, helicase, and single-stranded DNA-dependent dTTPase activities. The constraints of primase recognition sequences, nucleotide substrate requirements, and the effects of additional proteins on oligoribonucleotide synthesis by the 63-kDa gene 4 protein have been examined using templates of defined sequence. A three-base sequence, 3'-CTG-5', is necessary and sufficient to support the synthesis of pppAC dimers. dTTP hydrolysis is essential for oligoribonucleotide synthesis. Addition of a 7-fold molar excess of 56-kDa gene 4 protein to 63-kDa protein increases the number of oligoribonucleotides synthesized by 63-kDa protein 100-fold. The increase in oligonucleotides results predominantly from an increase in the synthesis of tetramers, with relatively little change in the synthesis of dimers and trimers. The presence of 56-kDa protein also causes 63-kDa protein to synthesize "pseudo-templated" pppACCCC pentamers at the recognition sequence 3'-CTGGG-5'. T7 gene 2.5 protein, a single-stranded DNA binding protein, increases the total number of oligoribonucleotides synthesized by 63-kDa gene 4 protein on single-stranded M13 DNA, but has no effect on the ratio of dimers to trimers and tetramers.

Amino Acid Sequence↗
PubMed1990

Base mispair extension kinetics. Comparison of DNA polymerase alpha and reverse transcriptase.

A polyacrylamide gel assay is used to measure the kinetics of adding a single deoxyribonucleotide onto either a correctly matched or mismatched primer 3' terminus (on M13 template) for all possible DNA base pairs and mispairs using Drosophila melanogaster DNA polymerase alpha (Pol alpha) and avian myeloblastosis virus reverse transcriptase. The reverse transcriptase catalyzes chain extension from transition mispairs (Pur.Pyr and Pyr.Pur, where Pur is purine and Pyr is pyrimidine) more efficiently than polymerase alpha. Reverse transcriptase extends G(primer).T almost 20% as efficiently as it extends A.T, while Pol alpha's G.T extension efficiency is less than 1%. For transversion mispairs (Pur.Pur and Pyr.Pyr), reverse transcriptase extends C.T and T.T with greater efficiency than polymerase alpha, while polymerase alpha is more efficient at extending A.G and G.G mispairs. Reverse transcriptase and polymerase alpha extend the G.G mispair at an efficiency of only 10(-6) and 10(-5), respectively, compared with G.C extension. The extension data for the two polymerases are compared with previously reported nucleotide misinsertion data for the same enzymes (Mendelman, L. V., Boosalis, M. S., Petruska, J., and Goodman, M. F. (1989) J. Biol. Chem. 264, 14415-14423). While the results obtained with reverse transcriptase and Pol alpha differ in detail, some general rules are indicated: (a) Pur.Pyr and Pyr.Pur mispairs, especially G.T and T.G, are easy to insert and even easier to extend; (b) Pyr.Pyr mispairs, especially C.C, are difficult to insert and slightly easier to extend; (c) Pur.Pur mispairs, notably G.G, are harder to extend than to insert. The comparison also shows that reverse transcriptase extends almost all mismatches more efficiently than it forms them, G.G being the only mismatch having a significantly lower efficiency of extension than insertion. Polymerase alpha inserts A.A mismatches most efficiently, but extends them inefficiently, thereby reducing the probability that such transversion mutations will occur in vivo. We show theoretically that when mispaired primers compete with properly matched primers for extension by polymerase, the relative velocities of extension depend on the concentration of the next correct dNTP substrate. The extension velocities depart from Michaelis-Menten kinetics by exhibiting positive cooperativity with respect to substrate concentration.

Animals↗
PubMed1989

Nearest neighbor influences on DNA polymerase insertion fidelity.

The kinetics of forming all possible single base substitution errors are measured for Drosophila melanogaster DNA polymerase alpha and avian myeloblastosis virus reverse transcriptase. Seventeen sites along bacteriophage M13 DNA are investigated so that effects of nearest neighbor base stacking on misinsertion kinetics can be evaluated. Polymerase alpha appears to be more error prone than reverse transcriptase. Polymerase alpha forms transversion mispairs at rates comparable to transition mispairs with two exceptions; A.A and C.C are formed with significantly higher and lower efficiencies, respectively. Reverse transcriptase forms transversions with lower efficiencies than transitions, especially low being A.G, G.G, and C.C. For both enzymes, misinsertion frequencies vary typically by 10-fold for the same mispair in different locations. Misinsertion frequency can be expressed as a product of two components, one based on Km and the other on Vmax. DNA polymerase alpha appears to use primarily Km discrimination (100-5000-fold) to achieve insertion fidelity while reverse transcriptase shows a greater balance between Km and Vmax discrimination. Nearest-neighbor base stacking interactions appear to have opposite effects on the two discrimination components. The 5'-nearest neighbor influence on Km is greater for correct insertions than for incorrect, while the influence on Vmax is greater for the incorrect base. Target sites that have pyrimidine as the 5'-nearest neighbor to incoming nucleotides show a higher than average misinsertion component based on Km, but a lower than average component based on Vmax. Conversely, target sites with nearest neighbor purines have a higher than average Vmax component. These results imply that nucleotide misinsertion "hot spots" will occur next to pyrimidines when Km discrimination is dominant and next to purines when Vmax discrimination is dominant. When Vmax and Km discrimination components have similar magnitudes, nearest neighbor effects tend to cancel thereby reducing the effects of base stacking on insertion error rates.

Animals↗
PubMed1986

General selection for specific DNA-binding activities.

We present a general strategy for the selection of bacterial clones that express DNA-binding activities corresponding to particular DNA recognition sites. The selection uses a "challenge phage" vector, P22 Kn9 arc-amH1605, into which is substituted a synthetic DNA-binding site for a site that controls transcription of the P22 antirepressor (ant) gene. Constitutive synthesis of antirepressor channels a challenge phage into lytic development and efficiently kills an infected host, unless the substituted site is bound by a specific protein; in this case, the challenge phage prefers lysogenic development, and the host survives and acquires an antibiotic-resistance phenotype. Infections with challenge phages carrying the E. coli Lac operator, phage lambda OL1 operator, or synthetic, "idealized" E. coli Trp and Tn10 Tet operators select clones that express each of the corresponding binding activities. The use of challenge phage vectors may be extended to select clones that express eukaryotic DNA-binding activities.

Base Sequence↗