Search PubMed⌕ Search

Biomedical subjects

L M Weiss

Publications and source records attributed to L M Weiss.

At least 253 records · Page 14Linked to original sources
PubMed1991

Light microscopic diagnosis of human microsporidiosis and variable response to octreotide.

Microsporida are protozoan parasites that have recently been identified as a cause of human disease in immunocompromised patients. Because of their small size, they have been recognized primarily by electron microscopy. This has limited the study of their prevalence, incidence, and association with large-volume diarrhea. The present report describes two cases of Enterocytozoon bieneusi infection of the small intestine in patients with intractable diarrhea in whom the diagnosis was made by light microscopy and confirmed by electron microscopy. Both patients were treated with octreotide, and one had a good response.

Acquired Immunodeficiency Syndrome↗
PubMed1991

Pseudomalignant ulcerative change of the gastrointestinal tract.

The occurrence of pseudomalignant ulcerative change in seven specimens from the colon and rectum of six patients is described. In all cases, there was surface ulceration of a polypoid lesion which contained granulation tissue and acute and chronic inflammation. There was an underlying inflammatory pseudopolyp in four lesions, a juvenile polyp in one lesion, an adenomatous polyp in one lesion, and a benign retention polyp in one lesion. Within the stroma of all cases were numerous atypical cells that mimicked a malignant neoplasm. The atypical cells expressed vimentin in immunohistochemical studies; no expression of keratins, leukocyte common antigen, factor VIII, Ulex europaeus, carcinoembryonic antigen, actin, or desmin was found. Recognition of this lesion is important, as confusion with carcinoma, lymphoma, sarcoma, or a viral infection may easily occur.

Adolescent↗
PubMed1991

Epstein-Barr virus infections and Hodgkin's disease: a study of fixed tissues using the polymerase chain reaction.

Epstein-Barr viral (EBV) infections are associated with Hodgkin's disease (HD). To better characterize this relationship, fixed tissues of infectious mononucleosis, normal and reactive lymph nodes, lymph nodes with progressively transformed germinal centers, and biopsy specimens with the different subtypes of HD were analyzed by polymerase chain reaction (PCR). The presence or absence of EBV, the relative amounts of EBV, and the presence of multiple EBV genotypes as defined by amplification of a polymorphic EBV locus were determined for each specimen. Epstein-Barr virus could be detected from all specimens with infectious mononucleosis (eight of eight cases), generally in relatively large amounts, with multiple EBV genotypes evident in two cases. Epstein-Barr virus could not be detected from normal or reactive lymph nodes (none of 39 cases). Small amounts of EBV could be detected from a minority of cases with progressively transformed germinal centers (two of 16 cases), with multiple EBV genotypes evident in one case. Variable amounts of EBV could be detected from approximately half of the specimens with HD (26 of 50 cases). Epstein-Barr virus was most often detected in the subtypes of mixed cellularity (12 of 15 cases), nodular sclerosis (seven of 14 cases), and lymphocyte depletion (five of seven cases) compared with nodular lymphocyte predominance HD (two of 14 cases). In contrast to specimens with infectious mononucleosis and progressively transformed germinal centers, only one EBV genotype was evident in the specimens with HD. These findings are consistent with the hypothesis that some cases of HD may be directly associated with EBV.

Base Sequence↗
PubMed1991

Carcinomas with metaplasia and sarcomas of the breast.

The clinicopathologic, immunohistochemical, and flow cytometric characteristics of 34 cases of mammary carcinoma with metaplasia were compared with those of 20 cases of pure sarcoma of the breast. All 20 of the latter tumors showed the pattern of malignant fibrous histiocytoma. There were 20 cases of carcinoma with mesenchymal metaplasia, 7 cases of carcinoma with mixed epithelial (squamous) and mesenchymal metaplasia, and 7 cases of carcinoma with epithelial metaplasia (four mixed ductal/squamous and three pure squamous cell carcinomas). No patient with pure sarcoma had lymph node metastases develop; all nodal metastases were found in patients who had carcinoma with metaplasia, although in one case the carcinomatous component was seen only within a lymph node metastasis. Epithelial antigens were found not only within the epithelial elements of all cases of carcinoma, but also within the apparent mesenchymal elements of 44% of the carcinomas showing divergent differentiation. Flow cytometric analysis of eight cases of carcinoma with mesenchymal metaplasia showed aneuploidy/tetraploidy in six neoplasms. For patient management purposes, the distinction of pure sarcoma from carcinoma with metaplasia is important, but additional subclassification of carcinoma with metaplasia is of greater biologic than clinical interest.

Adult↗
PubMed1991

Herpes simplex lymphadenitis.

Localized herpetic lymphadenitis is an extremely uncommon complication of herpes simplex virus (HSV) infection. The authors report two cases of localized herpetic lymphadenitis, both showing well-circumscribed areas of necrosis containing cells with diagnostic intranuclear inclusions. Electron microscopic studies in both cases revealed characteristic viral particles, and in situ hybridization studies using a herpes simplex genomic probe demonstrated HSV DNA in both specimens. Immunohistochemical studies demonstrated that the cells containing the inclusions were stromal, not lymphoid, cells. Combining the current two cases with the six well-documented cases previously reported in the literature, seven of the eight cases of HSV lymphadenitis have developed in inguinal lymph nodes, with four occurring in patients with previously or subsequently diagnosed hematopoietic malignancies, including both patients in the current series.

Adult↗
PubMed1991

Sensitive and specific detection of toxoplasma DNA in an experimental murine model: use of Toxoplasma gondii-specific cDNA and the polymerase chain reaction.

Toxoplasma gondii, an apicomplexan parasite of mammals and birds, is well recognized as a cause of encephalitis in AIDS patients and as a cause of congenital infections. The polymerase chain reaction (PCR) and toxoplasma cDNA clones were used to diagnose T. gondii infection in an acute murine model of toxoplasmosis. Diagnosis of tissue infection by Southern blot hybridization with cDNA clones of T. gondii was possible within 5 days of infection. This technique could detect as few as 10,000 organisms. Specific T. gondii gene amplification by PCR using the primers 5'CACACGGTTGTATGTCGGTTTCGCT3' and 5'TCAAGGAGCTCAATGTTACAGCCT3' followed by oligonucleotide hybridization using 5'GCGGTCATTCTCACACCGACGGAGAACCACTTCACTCTCA3' allowed detection of T. gondii in the tissue of mice by day 2 after infection and in the blood of mice by day 5 after infection with RH strain T. gondii. This technique could detect as few as 10 organisms. Thus, these techniques may be useful in the diagnosis of toxoplasmosis.

Animals↗
PubMed1991

Anaplastic thyroid carcinoma with osteoclast-like giant cells. A clinicopathologic, immunohistochemical, and ultrastructural study.

Two anaplastic thyroid carcinomas with osteoclast-like giant cells (OCL-GC) are reported. Light microscopically, one case resembled an aneurysmal bone cyst with cellular connective-tissue septae separating cavernous, blood-filled sinuses. The second case had sheets of anaplastic cells and a separate focus of papillary carcinoma without areas of transition. Multinucleate OCL-GC, pleomorphic mononuclear cells, and histiocytoid mononuclear cells with nuclei similar to those within the OCL-GC were seen in each case. With formalin-fixed, paraffin-embedded tissue, the majority of OCL-GC and histiocytoid mononuclear cells in both cases showed immunoreactivity using monoclonal antibodies to vimentin and KP-1, with the latter preparation directed against cells of monocytic/histiocytic lineage. Staining for keratin, epithelial membrane antigen, neuron-specific enolase, chromogranin, calcitonin, and thyroglobulin was negative in all cell types. Ultrastructural examination of one case showed two distinct types of mononuclear cells--one with morphologic characteristics similar to those of the OCL-GC, and another with pleomorphic nuclei and short cytoplasmic extensions joined by poorly formed desmosomes. The findings indicate that the anaplastic thyroid carcinomas studied represent poorly differentiated epithelial tumors infiltrated by reactive OCL-GC of monocytic/histiocytic lineage apparently derived from histiocytoid mononuclear cells via cellular fusion.

Carcinoma↗
PubMed1991

Infectious mononucleosis. Diagnosis by in situ hybridization in two cases with atypical features.

Two cases of infectious mononucleosis are reported in which in situ hybridization studies were of use to distinguish this disorder from non-Hodgkin's lymphoma. One patient was an 80-year-old man with a tonsillar mass that histologically resembled non-Hodgkin's lymphoma and, on fixed tissue immunohistochemistry, appeared to contain a population of cells anomalously coexpressing the B-cell marker L26 and the T-cell marker Leu-22, suggesting diffuse large-cell non-Hodgkin's lymphoma. The second patient was a 43-year-old woman with inguinal lymphadenopathy that, on histologic examination, also mimicked diffuse large-cell lymphoma. In situ hybridization studies for Epstein-Barr virus revealed both cases to possess EBV DNA in a pattern characteristic of infectious mononucleosis. In addition, in situ hybridization studies for immunoglobulin light-chain mRNA demonstrated a polyclonal pattern of kappa and lambda mRNA expression. This report demonstrates the utility of the in situ hybridization technique as an adjunct to routine diagnosis.

Aged↗
PubMed1991

Clear cell tumor of the lung. Immunohistochemical and ultrastructural evidence of melanogenesis.

Clear cell tumors of the lung (CCTL) are rare neoplasms of uncertain differentiation. A previous study of eight CCTL demonstrated a lack of epithelial features, but their exact nature remained unknown. In the current study of nine CCTL, immunohistochemistry using preliminary enzymatic digestion showed strong reactivity with the antimelanocytic markers HMB-45 (seven cases) and HMB-50 (six cases) and focal positivity for S-100 (nine cases), neuron-specific enolase (three cases), synaptophysin (one case), and Leu-7 (one case). Staining for cytokeratin, epithelial membrane antigen, chromogranin, and glial fibrillary acid protein was uniformly negative. Frozen-section immunoreactivity for vimentin and the antimelanocytic monoclonal preparation NKI/BETEB was noted in the one CCTL for which snap-frozen tissue was available. Ultrastructural examination of three glutaraldehyde-fixed CCTL showed rare neoplastic cells containing the full spectrum of melanosomes in two, one of which also contained neurosecretory-type granules. Aberrant melanosomal forms were identified in the third case. Melanosomes were not identified in the remaining five CCTL studied from formalin- or paraffin-retrieved material. The findings indicate that CCTL exhibits melanocytic differentiation. This feature may be of considerable value in distinguishing CCTL from other clear cell neoplasms.

Antibodies, Monoclonal↗
PubMed1991

Ber-EP4 antibody as a discriminant in the differential diagnosis of malignant mesothelioma versus adenocarcinoma.

The pathologic diagnosis of malignant mesothelioma is often difficult, even with the benefit of special studies such as histochemistry, electron microscopy, and immunohistochemistry. Ber-EP4 is a newly characterized monoclonal antibody that reliably labels epithelial tissues but does not react with mesothelial cells. We evaluated Ber-EP4 on formalin-fixed, paraffin-embedded tissue sections from 115 malignant mesotheliomas and 83 adenocarcinomas. Although 72 cases (87%) of adenocarcinoma were positive for Ber-EP4, only one (1%) of the mesotheliomas was reactive. The only adenocarcinomas that did not stain were from the breast (eight of 25 cases nonreactive) and the kidney (all three cases nonreactive). The staining pattern in the positive adenocarcinomas was usually intense and membranous, but additional weak cytoplasmic staining was seen in many cases. The reactivity was diffuse in 59 cases and focal in 13 cases. The results of our study suggest that the Ber-EP4 antibody may have great use in the differential diagnosis of mesothelioma versus adenocarcinoma, particularly when only formalin-fixed tissue is available.

Adenocarcinoma↗
PubMed1991

Successful management of intractable cryptosporidial diarrhea with intravenous octreotide, a somatostatin analogue.

A 38-year-old man with AIDS and intractable large-volume diarrhea due to a cryptosporidial infection was successfully treated with intravenous octreotide, a somatostatin analogue. The volume of diarrhea, 10-12 liters with 8-13 movements per day, was reduced to three to four semi-formed to formed stools per day when the patient was treated with 400 micrograms intravenous octreotide daily. The patient's intravenous hyperalimentation was discontinued and he returned to oral feeding. He quickly regained his normal weight and has now resumed his normal activities. For those patients who cannot tolerate subcutaneous administration, intravenous octreotide therapy may not only be life-saving but may also markedly increase the quality of life. Roxithromycin, a macrolide antibiotic, was also administered to this patient with cryptosporidiosis but efficacy was not demonstrated.

Acquired Immunodeficiency Syndrome↗
PubMed1991

Effects of different fixatives on detection of nucleic acids from paraffin-embedded tissues by in situ hybridization using oligonucleotide probes.

Detection of nucleic acids from paraffin-embedded material by in situ hybridization with oligonucleotide probes is increasingly being used. To determine the effect of fixation on the preservation of DNA and mRNA, we studied 18 lymphoid tissues fixed in B5, formalin, OmniFix, ethanol, and Bouin's fixatives and embedded in paraffin by in situ hybridization, using biotinylated oligonucleotide poly d(T) probes and immunoglobulin light chain probes. Detection of DNA using the poly d(T) probe was most consistent and most intense in tissue fixed in formalin, followed by OmniFix and ethanol, with B5 and Bouin's fixatives yielding unsatisfactory results. Detection of mRNA, using the light chain probes, was most consistent and most intense with tissue fixed in formalin and Bouin's solution, followed by B5 fixative, with OmniFix and ethanol fixatives yielding unsatisfactory results. The results of mRNA detection using the poly d(T) probe were found not to correlate with mRNA content as determined by the light chain probes for several fixatives, possibly owing to selective degradation of portions of the mRNA molecule.

Acetates↗
PubMed1991

Similar outcome of treatment of B-cell and T-cell diffuse large-cell lymphomas: the Stanford experience.

Although previous studies have suggested a relatively poor prognosis for some patients with peripheral T-cell lymphoma, the clinical significance of immunologic phenotype in diffuse large-cell lymphoma (DLCL) remains controversial. One hundred one patients with a uniform morphologic diagnosis of DLCL treated at Stanford between 1975 and 1986 with cyclophosphamide, Adriamycin (doxorubicin; Adria Laboratories, Columbus, OH), vincristine, and prednisone (CHOP), methotrexate, bleomycin, Adriamycin, cyclophosphamide, vincristine, and dexamethasone ([M]BACOD), or methotrexate, Adriamycin, cyclophosphamide, vincristine, prednisone, and bleomycin (MACOP-B) chemotherapy were studied with regard to immunologic phenotype. Immunologic analysis, performed on frozen or paraffin-embedded tissue, identified 77 cases of B-cell origin, 21 cases of T-cell origin, and three cases that lacked B-cell or T-cell markers. Analysis of complete remission (CR) rates (84% v 95%), 5-year actuarial freedom from disease progression (38% v 53%), and 5-year actuarial overall survival (52% v 79%) showed no statistically significant differences in prognosis between B- and T-cell patients, respectively. The 5-year actuarial survival of patients with stage IV T-cell DLCL (56%) also did not differ in a statistically significant way from stage IV B-cell patients (36%). We conclude that treatment selection for DLCL should not be based on immunologic phenotype alone.

Actuarial Analysis↗
PubMed1991

Association of Epstein-Barr virus with undifferentiated gastric carcinomas with intense lymphoid infiltration. Lymphoepithelioma-like carcinoma.

Some undifferentiated gastric carcinomas with intense lymphoid infiltration have a striking resemblance to nasopharyngeal lymphoepithelioma. The authors identified eight such cases (seven patients from Japan and one from the United States) of undifferentiated gastric carcinoma (lymphoepithelioma-like carcinoma [LELC]) and examined them for Epstein-Barr (EBV) viral sequences using polymerase chain reaction (PCR) and in situ hybridization (ISH) techniques. EBV was detected in seven of the eight cases by PCR, including a lymph-node metastasis. ISH that was performed in six of these cases showed EBV genomes to be uniformly present in the carcinoma cells and not present in the reactive lymphoid infiltrate or normal gastric mucosa. PCR of a polymorphic EBV locus (lymphocyte-determined membrane antigen) showed that a single genotype was present in each gastric LELC, consistent with a clonal process. These findings suggest that some undifferentiated gastric carcinomas are EBV-related and that focal EBV infection occurs before transformation.

Antigens, Surface↗
PubMed1991

Epstein-Barr virus and Hodgkin's disease. A correlative in situ hybridization and polymerase chain reaction study.

The authors studied typical Hodgkin's disease along with the nodular, lymphocyte predominance subtype by both the polymerase chain reaction (PCR) and in situ hybridization for evidence of the Epstein-Barr virus (EBV). By PCR, EBV DNA was detected in 12/23 cases of typical Hodgkin's disease and 2/13 cases of the nodular, lymphocyte predominance subtype. EBV RNA was detected by in situ hybridization studies within Reed-Sternberg cells and variants in 11/23 cases of typical Hodgkin's disease and 0/13 cases of nodular, lymphocyte predominance Hodgkin's disease. Other cells positive for EBV, identified as both B and T cells in double-labeling immunohistochemical/in situ hybridization studies, were found in 20/23 cases of typical Hodgkin's disease, 9/13 cases of nodular, lymphocyte predominance Hodgkin's disease, 4/6 cases of progressive transformation of germinal centers, and 7/10 normal lymphoid tissues. It is concluded that EBV is significantly associated with Reed-Sternberg cells in approximately one-half cases of typical Hodgkin's disease but not in the nodular, lymphocyte predominance subtype. EBV-infected B and T cells are also present in a majority of cases of Hodgkin's disease as well as in reactive conditions.

DNA, Viral↗
PubMed1991

Immunocytochemical characterization of a monoclonal antibody directed against mitochondria reactive in paraffin-embedded sections.

The monoclonal antibody mES 13 was previously produced against bacterially expressed BALB ras p21 and was reported to have both membrane and cytoplasmic reactivity in formalin-fixed, paraffin-embedded tissue sections. In the current study, the cytoplasmic reactivity of mES 13 is investigated and demonstrated to be mitochondrial. Immunoelectron microscopic studies showed specific labeling of mitochondria without labeling of other organelles. In normal tissues, the antibody strongly labeled tissues known to have large amounts of mitochondria such as renal tubules, hepatocytes, and myocardium. The pattern of reactivity of tumors generally mimicked that of normal tissues, with carcinomas and melanomas usually showing stronger staining than sarcomas and lymphomas. Two granular cell tumors were negative. Among renal neoplasms, mES 13 strongly labeled renal oncocytomas and granular cell renal cell carcinomas and showed weaker staining of clear cell and chromophobe cell tumors. The mES 13 antibody should be useful in the characterization and diagnosis of tumors in which oncocytoma is in the differential diagnosis, especially when only paraffin-embedded tissue is available for study.

Adenoma↗