Search PubMed⌕ Search

Biomedical subjects

L Kaufman

Publications and source records attributed to L Kaufman.

At least 379 records · Page 21Linked to original sources
PubMed1982

Resolution and contrast recovery at depth in planar nuclear images.

Resolution and contrast recovery in planar nuclear images at depth with a high purity germanium (HPGe) camera has been achieved through use of a weighted back projection (WBP) method. The algorithm can be derived from Bayes' theorem using the point spread function of the camera. The variations in the formulation of WBP (one single pass and two iterative procedures) are presented with the characteristics and performance of each method. The evaluation procedure determines the behaviour of signal-to-noise ratio, contrast and texture after application of the algorithm. Both real and simulated cold lesions obtained with the HPGe camera are studied with sizes ranging from 3 mm to 17 mm and background count densities from 100 to 6400 counts cm2. Application of WBP is shown to increase spatial resolution and contrast without a concomitant reduction in signal-to-noise ratio. Images obtained with the HPGe camera and processed with WBP are presented. The algorithm has been applied to the scintillation camera, yielding significant resolution and contrast recovery despite the presence of scatter and textured noise present in the HPGe images.

Animals↗
PubMed1982

Safety considerations in handling exoantigen extracts from pathogenic fungi.

Currently, exoantigen test procedures for identifying mycelial form cultures of pathogenic molds require that the fungi being extracted be treated with thimerosal to render them safe for handling. Recent studies have demonstrated that thimerosal may not be fungicidal. In view of these reports, we investigated the effects of thimerosal and formaldehyde on a variety of exoantigen preparations. Mature mycelial form fungal cultures, including cultures of Blastomyces dermatitidis, Coccidioides immitis, and Histoplasma capsulatum and morphologically similar fungi, were grown on Sabouraud dextrose agar slants and treated with 0.02, 0.04, and 0.08% thimerosal for 24 and 48 h and with 0.2 and 0.5% formaldehyde for 24 and 48 h. We found that 0.5% formaldehyde killed all of the fungi studied, whereas 0.2% formaldehyde permitted the growth of only one fungus; 0.02, 0.04, and 0.08% thimerosal were fungistatic. Furthermore, 0.2 and 0.5% formaldehyde and 0.08% thimerosal affected certain antigens adversely. For those investigators who prefer to use 0.02% thimerosal and to work with sterile extracts, we recommend that the procedure be modified, and we advocate sterilization of extracts by passage through membrane filters.

Antigens, Fungal↗
PubMed1982

Antigenic characterization of Cryptococcus neoformans serotypes and its application to serotyping of clinical isolates.

Antigenic analysis of the four serotypes of Cryptococcus neoformans was carried out by slide agglutination with reciprocal adsorption methods. With this procedure the antigenic patterns of the serotypes were established. Serotypes A and D had antigenic factors 1, 2, 3, 7 and 1, 2, 3, 8, respectively. Serotypes B and C were found to have antigenic factors 1, 2, 4, 5 and 1, 4, 6, respectively. Factor sera, prepared according to the antigenic patterns demonstrated by adsorption studies, proved to be useful for rapidly and accurately identifying C. neoformans serotypes. Some patterns similar to those of the C. neoformans serotypes were observed in five other Cryptococcus species and two Candida species. The proton magnetic resonance spectra of polysaccharides from the C. neoformans serotypes correlated well with their antigenic characteristics. Phenol oxidase test reactions and growth at 37 degrees C were useful criteria for determining which yeasts should be chosen for clinical application of factor sera for serotyping of C. neoformans. Sixty-two Japanese isolates of C. neoformans were serotyped. Fifty-eight of these isolates were serotype A, three were serotype A-D, and one was serotype D.

Agglutination Tests↗
PubMed1982

Magnetic field of the human sensorimotor cortex.

A magnetic field associated with voluntary finger flexion was found to be confined over a well-defined region of the scalp overlying the sensorimotor cortex contralateral to the finger. The magnetic field had opposite directions over two regions of the scalp superior and inferior to the classical finger area of the cortex, implying that the field was generated by a source or sources in this area. The field whose onset begins approximately 50 ms prior to muscle activation was associated with a cortical source lying about 2.8 cm beneath the scalp and the active area shifted posteriorly 3-6 mm into the somatosensory area during the finger movement. Consistent with this shift, the early component of the magnetic field prior to flexion of a finger was absent when it was passively moved by the finger of the opposite hand, but the later components were present.

Afferent Pathways↗
PubMed1982

Nuclear magnetic resonance imaging: current capabilities.

Nuclear magnetic resonance imaging can produce tomographic images of the body without ionizing radiation. Images of the head, chest, abdomen, pelvis and extremities have been obtained and normal structures and pathology have been identified. Soft tissue contrast with this method is superior to that with x-ray computerized tomography and its spatial resolution is approaching that of x-ray computerized tomography. In addition, nuclear magnetic resonance imaging enables us to image along the sagittal and coronal planes directly, and it does not produce obscuring artifacts by bone.

Humans↗
PubMed1981

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.

Animals↗
PubMed1981

Localization of mammary tumors in vivo with 131I-labeled Fab fragments of antibodies against mouse mammary epithelial (MME) antigens.

The Fab fragments of antibodies against cell-type-specific surface antigens of mouse mammary epithelial cells (MME-antigens) were used to localize mammary tumors successfully. The radioiodine-labeled anti-MME (Fab) was injected into mice carrying simulated mammary metastases, and after 24 hours the amount of label per gram of excised tissue was several times greater in the tumor than in liver, brain, lung, or muscle. Kidney showed considerable accumulation of label but this appeared to be nonspecific. Kinetic studies revealed a rapid elimination of labeled Fab in the urine with only 1% of the injected dose remaining in the entire blood pool after 24 hours. Wit a high-purity germanium camera, mammary tumors were clearly located ty the 131I-labeled anti-MME (Fab), and normalization to 99mTc-pertechnetate distribution in the animal increased the specificity. The density of 131I-label was fourfold greater over the mammary tumor than over comparable areas of the mouse. No accumulation of 131I-anti-MME (Fab) was observed in nonmammary tumors nor in mammary tumors when labeled nonspecific Fab was used. An analogous system using an antihuman mammary epithelial antiserum is being developed for localization of breast metastases in humans.

Animals↗
PubMed1981

Outbreak of acute pulmonary histoplasmosis in members of a wagon train.

In August 1980, an outbreak of acute pulmonary histoplasmosis occurred among participants in a wagon train as it traveled through eastern Tennessee. Of the 85 people on the train 69 (81 percent) had evidence of infection with Histoplasma capsulatum. Fifty-four people had symptomatic disease. The source of infection was traced to the site of a former winter blackbird roost in Charleston, Tennessee, that had been partially cleared five years earlier to make a park. Fourteen of 25 soil samples from this site were culture-positive for H. capsulatum. This is the first reported outbreak to involve a large migrant group. The outbreak is unusual in that exposure occurred without excavation, construction or tree-cutting at the site.

Adult↗