Search PubMed⌕ Search

Biomedical subjects

L B Hersh

Publications and source records attributed to L B Hersh.

At least 19 recordsLinked to original sources

Selective age-related loss of calbindin-D28k from basal forebrain cholinergic neurons in the common marmoset (Callithrix jacchus).

A significant number of the cholinergic neurons in the basal forebrain of the primate, but not the rodent brain contain the calcium binding protein calbindin-D28k (CB). Previous experiments in our laboratory have demonstrated a substantial age-related loss of CB from the human basal forebrain cholinergic neurons (BFCN). The present study investigated the possible age-related loss of CB from the BFCN in a non-human primate species, the common marmoset (Callithrix jacchus). Quantitative analysis of matching sections as well as unbiased stereological determination of neuronal number were used in 16 adult marmosets ranging in age between 2 and 15 years. No significant changes were observed in the number of choline acetyltransferase-positive BFCN when a group of young animals (< or =4 years) was compared with a 6-8-year-old group and a 9-15-year-old group. Similarly, no age-related changes were observed in Nissl-stained magnocellular basal forebrain (putatively cholinergic) neurons. In contrast, the BFCN of the two older groups of animals displayed a significant loss of CB. The age-related loss of CB occurred in all sectors of the BFCN, but was greatest in the anterior sector of this cell group. The CB loss was neurochemically specific since the BFCN in the older groups of animals continued to express other markers such as high and low affinity neurotrophin receptors. The age-related loss of CB from the marmoset BFCN was also regionally selective as CB positive neurons in other structures, such as the cerebral cortex and the striatum displayed no apparent age-related changes. These results indicate that the marmoset BFCN display a significant and selective age-related loss of CB reminiscent of that observed in the human. Therefore, the common marmoset represents an appropriate animal model in which the consequences of BFCN CB loss can be investigated in depth. Loss of CB from the aged BFCN is likely to reduce the capacity of these neurons to buffer intracellular calcium and to leave them vulnerable to insults which can result in increased calcium levels. The vulnerability of the CB-negative BFCN in the aged marmoset to various insults which disturb calcium homeostasis remains to be investigated.

Aging↗

Expression of the acidic stretch of nardilysin as a functional binding domain.

Kinetic evidence suggests an acidic region in nardilysin binds polyamines and acts as a regulatory domain. The binding of approximately 5 mol of spermine/mol of nardilysin was demonstrated. The binding curve was sigmoidal exhibiting an IC(50) of approximately 118 microM and a Hill coefficient of 1.8. Spermine diminished the tryptophan fluorescence of the enzyme and increased its sensitivity to protease V8. The acidic stretch from mouse and human nardilysin were expressed as glutathione transferase fusion proteins. All fusion proteins bound spermine with an IC(50) of 40 to 110 microM. The mouse fusion protein bound approximately 7 mol of spermine exhibiting a sigmoidal binding curve and a Hill coefficient of 1.4. The human acidic stretch, containing fewer acidic residues, bound approximately 5 mol of spermine/mol with a hyperbolic binding curve. Chimeric fusion proteins containing the N-terminus of the mouse acidic region fused to the C-terminus of the human acidic region bound approximately 10 mol of spermine, while the opposite chimera bound approximately 4 mol of spermine/mol. The N-terminal region of the mouse acidic domain binds 3--4 mol spermine/mol exhibiting a Hill coefficient of 1.4, while the same region from human nardilysin binds 1 mol of spermine/mol. Spermine enhanced the sensitivity of the mouse acidic domain, but not the human acidic domain, to protease V8. Together the data support a model where the acidic stretch of nardilysin functions as an autonomous domain.

Amino Acid Sequence↗

Analysis of the subsite specificity of rat insulysin using fluorogenic peptide substrates.

Recombinant rat insulysin was shown to cleave the internally quenched fluorogenic peptide 2-aminobenzyl-GGFLRKVGQ-ethylenediamine-2,4-dinitrophenol at the R-K bond, exhibiting a K(m) of 13 microm and a V(max) of 2.6 micromol min(-1) mg(-1). Derivatives of this peptide in which the P(2) leucine or the P(2)' valine were replaced with other residues were used to probe the subsite specificity of the enzyme. Varying the P(2) residue produced a 4-fold range in K(m) and a 7-fold range in k(cat). The nature of the P(2) residue had a significant effect on the site of cleavage. Leucine, isoleucine, valine, and aspartate produced cleavage at the R-K bond. Asparagine produced 36% cleavage at the N-R bond and 64% cleavage at the R-K bond, whereas with alanine or serine the A-R and S-R bonds were the major cleavage sites. With tyrosine, phenylalanine, methionine, or histidine representing the varied residue X, cleavages at F-X, X-R, and R-K were seen, whereas with tryptophan equal cleavage occurred at the F-W and W-R bonds. Variable P(2)' residues produce less of a change in both K(m) and k(cat) and have little influence on the cleavage site. Exceptions are phenylalanine, tyrosine, leucine, and isoleucine, which in addition to producing cleavage at the R-K bond, produce significant cleavage at the L-R bond. Alanine and tyrosine were unique in producing cleavage at the F-L bond. Taken together, these data suggest that insulysin specificity is directed toward the amino side of hydrophobic and basic residues and that the enzyme has an extended substrate binding site.

Amino Acid Sequence↗

Role of zinc finger domains of the transcription factor neuron-restrictive silencer factor/repressor element-1 silencing transcription factor in DNA binding and nuclear localization.

The transcription factor neuron-restrictive silencer factor/repressor element-1 (RE-1) silencing transcription factor (NRSF/REST) contains nine zinc finger domains and binds to the DNA element, neuron-restrictive silencer element/repressor element-1. REST4, a C-terminally truncated form of NRSF/REST, contains the five N-terminal zinc fingers and binds weakly to DNA yet is transported into the nucleus. To study the contribution of zinc fingers 6-8 to DNA binding, each was mutated. A mutation in zinc finger 6 or 8 had little effect; however, mutation of zinc finger 7 diminished DNA binding. Mutations in any two of these zinc fingers eliminated DNA binding. The contribution of zinc fingers 2-5 to nuclear targeting was studied. Deletion of zinc finger 5 prevented nuclear targeting. Mutations in zinc finger 2, 4, or 5 did not abolish nuclear targeting. However, a zinc finger 3 mutation together with a zinc finger 2 mutation localized to the nuclear envelope. A zinc finger 3 mutation alone or in combination with a zinc finger 4 or 5 mutation produced a punctate nuclear distribution. These results suggest the presence of signals for nuclear targeting, for nuclear entry, and for release from the translocation machinery within zinc fingers 2-5 of REST4.

Base Sequence↗

Identification and characterization of two androgen response regions in the human neutral endopeptidase gene.

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.

Androgens↗

Insulysin hydrolyzes amyloid beta peptides to products that are neither neurotoxic nor deposit on amyloid plaques.

Insulysin (EC. 3.4.22.11) has been implicated in the clearance of beta amyloid peptides through hydrolytic cleavage. To further study the action of insulysin on Abeta peptides recombinant rat insulysin was used. Cleavage of both Abeta(1-40) and Abeta(1-42) by the recombinant enzyme was shown to initially occur at the His(13)-His(14), His(14)-Gln(15), and Phe(19)-Phe(20) bonds. This was followed by a slower cleavage at the Lys(28)-Gly(29), Val(18)-Phe(19), and Phe(20)-Ala(21) positions. None of the products appeared to be further metabolized by insulysin. Using a rat cortical cell system, the action of insulysin on Abeta(1-40) and Abeta(1-42) was shown to eliminate the neurotoxic effects of these peptides. Insulysin was further shown to prevent the deposition of Abeta(1-40) onto a synthetic amyloid. Taken together these results suggest that the use of insulysin to hydrolyze Abeta peptides represents an alternative gene therapeutic approach to the treatment of Alzheimer's disease.

Amyloid beta-Peptides↗

Studies on the interaction of REST4 with the cholinergic repressor element-1/neuron restrictive silencer element.

REST4 is a neuron specific truncated form of the transcription factor REST/NRSE derived by alternative splicing. REST4 was previously shown to block the repressor activity of REST/NRSF by forming a hetero-oligomer, Shimojo et al. [Mol. Cell. Biol. 19 (1999) 6788-6795]. A series of deletion mutants have now been used to characterize REST4 in terms of its structure and DNA binding. REST4 was found to be O-glycosylated between between residues 87 and 152. Binding of REST4 to the cholinergic RE-1/NRSE was approximately 1/10 to 1/20 as strong as full length REST/NRSF. DNA binding was enhanced by deletion of the first 86 residues and was found to require all four of the C-terminal zinc fingers as well as a twelve amino acid sequence preceding the first of these zinc fingers. REST4 can form homo-oligomers, however only the monomer was found to bind to DNA. REST4 binds to the 3' sequence of the cholinergic NRSE suggesting an anti-parallel orientation of the protein to the DNA.

Alternative Splicing↗

Phosphorylation of the rat vesicular acetylcholine transporter.

Metabolic labeling of a mutant PC12 cell line, A123.7, expressing recombinant rat vesicular acetylcholine transporter (VAChT) with radiolabeled inorganic phosphate was used to demonstrate phosphorylation of the transporter on a serine residue. Mutational analysis was used to demonstrate that serine 480, which is located on the COOH-terminal cytoplasmic tail, is the sole phosphorylation site. Phosphorylation of serine 480 was attributable to the action of protein kinase C. Using a permanently dephosphorylated form of rat VAChT, S480A rVAChT, it was shown that this mutant displays the same kinetics for the transport of acetylcholine and the binding of the inhibitor vesamicol as does the wild type transporter. However, sucrose gradient density centrifugation showed that, unlike wild type VAChT, the S480A mutant did not localize to synaptic vesicles. These results suggest that phosphorylation of serine 480 of VAChT is involved in the trafficking of this transporter.

Acetylcholine↗

Studies on the subsite specificity of rat nardilysin (N-arginine dibasic convertase).

The subsite specificity of rat nardilysin was investigated using fluorogenic substrates of the type 2-aminobenzoyl-GGX(1)X(2)RKX(3)GQ-ethylenediamine-2,4- dinitrophenyl, where P(2), P(2)', and P(3) residues were varied. (The nomenclature of Schechter and Berger (Schechter, I., and Berger, A. (1967) Biochem. Biophys. Res. Commun. 27, 157-162) is used where cleavage of a peptide occurs between the P(1) and P(1)' residues, and adjacent residues are designated P(2), P(3), P(2)', P(3)', etc.) There was little effect on K(m) among different residues at any of these positions. In contrast, residues at each position affected k(cat), with P(2) residues having the greatest effect. The S(3), S(2), and S(2)' subsites differed in their amino acid preference. Tryptophan and serine, which produced poor substrates at the P(2) position, were among the best P(2)' residues. The specificity at P(3) was generally opposite that of P(2). Residues at P(2), and to a lesser extent at P(3), influenced the cleavage site. At the P(2) position, His, Phe, Tyr, Asn, or Trp produced cleavage at the amino side of the first basic residue. In contrast, a P(2) Ile or Val produced cleavage between the dibasic pair. Other residues produced intermediate effects. The pH dependence for substrate binding showed that the enzyme prefers to bind a protonated histidine. A comparison of the effect of arginine or lysine at the P(1)' or P(1) position showed that there is a tendency to cleave on the amino side of arginine and that this cleavage produces the highest k(cat) values.

Amino Acids↗

Neutral endopeptidase and alcohol consumption, experiments in neutral endopeptidase-deficient mice.

Alcohol consumption was investigated in mice which were rendered deficient in the peptide-degrading enzyme neutral endopeptidase (EC 3.4.24.11) (NEP-/-) by gene targeting and compared to alcohol consumption in corresponding wild type mice (NEP+/+). Mice were offered a free choice to drink tap water or 10% alcohol. The NEP-/- mice consumed significantly more alcohol ( approximately 42%) than the NEP+/+ mice, whereas no significant differences were observed in the total fluid consumption. The daily food consumption of alcohol naive NEP-/- animals was elevated ( approximately 29%). Furthermore, the activities of peptidases closely related to neutral endopeptidase were analysed ex vivo in several brain regions from NEP-/- and NEP+/+ mice not treated with alcohol. There was no obvious compensation for the total loss of neutral endopeptidase by the functionally related peptidases angiotensin-converting enzyme and aminopeptidase N. In vitro, the degradation of exogenously applied [Leu(5)]enkephalin was not reduced in membrane preparations of those brain regions assayed in NEP-/- mice. A small reduction in [Leu(5)]enkephalin degradation was detected in striatal membrane preparations of NEP-/- mice, if aminopeptidase N was additionally blocked by bestatin or amastatin.

Alcohol Drinking↗

Mutational analysis of basic residues in the rat vesicular acetylcholine transporter. Identification of a transmembrane ion pair and evidence that histidine is not involved in proton translocation.

The function of positively charged residues and the interaction of positively and negatively charged residues of the rat vesicular acetylcholine transporter (rVAChT) were studied. Changing Lys-131 in transmembrane domain helix 2 (TM2) to Ala or Leu eliminated transport activity, with no effect on vesamicol binding. However, replacement by His or Arg retained transport activity, suggesting a positive charge in this position is critical. Mutation of His-444 in TM12 or His-413 in the cytoplasmic loop between TM10 and TM11 was without effect on ACh transport, but vesamicol binding was reduced with His-413 mutants. Changing His-338 in TM8 to Ala or Lys did not effect ACh transport, however replacement with Cys or Arg abolished activity. Mutation of both of the transmembrane histidines or all three of the luminal loop histidines showed no change in acetylcholine transport. The mutant H338A/D398N between oppositely charged residues in transmembrane domains showed no vesamicol binding, however the charge reversal mutant H338D/D398H restored binding. This suggests that His-338 forms an ion pair with Asp-398. The charge neutralizing mutant K131A/D425N or the charge exchanged mutant K131D/D425K did not restore ACh transport. Taken together these results provide new insights into the tertiary structure in VAChT.

Acetylcholine↗

Cyto- and chemoarchitecture of basal forebrain cholinergic neurons in the common marmoset (Callithrix jacchus).

The cyto- and chemoarchitecture of basal forebrain cholinergic neurons (BFCN) was investigated in the lower primate, the common marmoset (Callithrix jacchus). A large population of magnocellular, hyperchromic, and choline acetyltransferase (ChAT)-positive neurons was detected in the marmoset basal forebrain. The distribution of these neurons was similar to those in higher primates. Thus, ChAT-positive neurons were observed in the medial septum (Ch2), the vertical (Ch2) and horizontal (Ch3) limbs of the diagonal band of Broca, and the nucleus basalis of Meynert (Ch4). The Ch4 complex was relatively well differentiated and displayed distinct sectors. We detected anterior (Ch4a, with a medial and a lateral subdivision), intermediate (Ch4i, with a dorsal and a ventral subdivision), and posterior (Ch4p) sectors in the marmoset Ch4. The Ch4i was relatively small while the Ch4p was large. Similar to the rodent, the marmoset Ch1 extended quite a distance posteriorly, and the Ch4p displayed a major interstitial component distributed within the globus pallidus, its medullary laminae, and the internal capsule. Virtually all of the marmoset BFCN displayed acetylcholinesterase activity, and low affinity (p75(NTR)) and high affinity (Trk) neurotrophin receptor immunoreactivity. A majority contained immunoreactivity for calbindin-D(28K) and calretinin. Many of the Ch4 neurons also displayed tyrosine hydroxylase immunoreactivity. The BFCN lacked galanin immunoreactivity, but were innervated by galanin-positive fibers. None of the marmoset BFCN were NADPH-d-positive. Thus, the BFCN display major anatomical and biochemical differences in the marmoset when compared with higher primates. The marmoset BFCN also display many characteristics common to other primates. This fact, combined with the relatively short life span of the marmoset, indicates that this species may be ideal for studies of age-related changes in the BFCN.

Acetylcholinesterase↗

Two new proteases in the MHC class I processing pathway.

The proteasome generates exact major histocompatibility complex (MHC) class I ligands as well as NH2-terminal-extended precursor peptides. The proteases responsible for the final NH2-terminal trimming of the precursor peptides had, until now, not been determined. By using specific selective criteria we purified two cytosolic proteolytic activities, puromycin-sensitive aminopeptidase and bleomycin hydrolase. These proteases could remove NH2-terminal amino acids from the vesicular stomatitis virus nucleoprotein cytotoxic T cell epitope 52-59 (RGYVYQGL) resulting, in combination with proteasomes, in the generation of the correct epitope. Our data provide evidence for the existence of redundant systems acting downstream of the proteasome in the antigen-processing pathway for MHC class I molecules.

Amino Acid Chloromethyl Ketones↗

Crystallization and preliminary analysis of neurolysin.

Neuropeptidases inactivate or modify the activity of peptide neurotransmitters and neurohormones. The neuropeptidase neurolysin acts only on short peptides and accepts a variety of cleavage-site sequences. Structures of the enzyme and enzyme-substrate complexes will help to determine the mechanisms of substrate selectivity used by this enzyme. Crystals of recombinant neurolysin have been grown in the orthorhombic space group P2(1)2(1)2, with unit-cell parameters a = 157.8, b = 88.0, c = 58.4 A. Data have been collected to 2.3 A at 110 K with observed diffraction to 1.8 A. Circular dichroism measurements suggest that the enzyme is primarily alpha-helical, with little beta-strand secondary structure. Sequence-based secondary-structure prediction supports this conclusion.

Animals↗

Expression patterns of mouse repressor element-1 silencing transcription factor 4 (REST4) and its possible function in neuroblastoma.

The expression pattern of the repressor element-1 silencing transcription factor (REST) also known as the neuron-restrictive silencer factor (NRSF) and its truncated forms have been analyzed in the neuroblastoma cell lines, NS20Y and NIE115 and in NIH3T3 cells. The neuroblastoma cell lines express transcripts of REST/NRSF and its neuron-specific truncated form REST4; with REST4 being the major transcript. NIH3T3 cells express predominantly REST/NRSF, with no detectable REST4. The cellular localization of REST4, determined using a REST4-GFP fusion protein, was shown to be nuclear. Mutational analysis implicates the zinc finger domains as the nuclear-targeting signal. Analysis of reporter-gene activities in the NS20Y cell line showed that the presence of four RE-1/NRSE sequences did not affect promoter activity. However, coexpression of exogenous REST4 produces a small increase in promoter activity of the reporter plasmid, whereas expression of exogenous REST/NRSF leads to repression. In the NIH3T3 cell line, the RE-1/NRSE sequence leads to repression of reporter-gene activity, whereas introduction of exogenous REST4 leads to de-repression. These data indicate that REST4 does not act as a transcriptional repressor. However, they support a mechanism where REST4 can block the repressor activity of REST/NRSF.

Acetylcholine↗

Preservation of nucleus basalis neurons containing choline acetyltransferase and the vesicular acetylcholine transporter in the elderly with mild cognitive impairment and early Alzheimer's disease.

Immunocytochemistry for choline acetyltransferase (ChAT) and the vesicular acetylcholine transporter (VAChT) was used to examine the expression of these linked cholinergic markers in human basal forebrain, including cases with early stages of Alzheimer's disease (AD). Previous neurochemical studies have measured decreased ChAT activity in terminal fields, but little change or even increased levels of VAChT. To determine total cholinergic neuron numbers in the nucleus basalis of Meynert (nbM), stereologic methods were applied to tissue derived from three groups of individuals with varying levels of cognition: no cognitive impairment (NCI), mild cognitive impairment (MCI), and early-stage Alzheimer's disease (AD). Both markers were expressed robustly in nucleus basalis neurons and across all three groups. On average, there was no significant difference between the number of ChAT- (210,000) and VAChT- (174, 000) immunopositive neurons in the nbM per hemisphere in NCI cases for which the biological variation was calculated to be 17%. There was approximately a 15% nonsignificant reduction in the number of cholinergic neurons in the nbM in the AD cases with no decline in MCI cases. The number of ChAT- and VAChT-immunopositive neurons was shown to correlate significantly with the severity of dementia determined by scores on the Mini-Mental State Examination, but showed no relationship to apolipoprotein E allele status, age, gender, education, or postmortem interval when all clinical groups were combined or evaluated separately. These data suggest that cholinergic neurons, and the coexpression of ChAT and VAChT, are relatively preserved in early stages of AD.

Aged↗

Cloning and analysis of the gene for the human puromycin-sensitive aminopeptidase.

The gene encoding the human puromycin-sensitive aminopeptidase (PSA) has been cloned and characterized. The human PSA gene is composed of 23 exons and 22 introns and spans approximately 40 kb of chromosome 17 at the interval 17q12-21. An analysis of the 5' end of the human PSA transcript reveals that the translational start site corresponds to nt 210 of the human PSA cDNA, as suggested by RT-PCR, 5' RACE, and computer analysis of expressed sequence tags. A comparison of the exon/exon boundaries of the human PSA gene with those of the human aminopeptidase N (APN) gene shows little conservation, suggesting that the two genes, which are closely related in protein sequence, diverged early during evolution.

Amino Acid Sequence↗