Search PubMed⌕ Search

Biomedical subjects

L A Loeb

Publications and source records attributed to L A Loeb.

At least 37 records · Page 2Linked to original sources
PubMed2000

Functional interaction between the Werner Syndrome protein and DNA polymerase delta.

Werner Syndrome (WS) is an inherited disease characterized by premature onset of aging, increased cancer incidence, and genomic instability. The WS gene encodes a 1,432-amino acid polypeptide (WRN) with a central domain homologous to the RecQ family of DNA helicases. Purified WRN unwinds DNA with 3'-->5' polarity, and also possesses 3'-->5' exonuclease activity. Elucidation of the physiologic function(s) of WRN may be aided by the identification of WRN-interacting proteins. We show here that WRN functionally interacts with DNA polymerase delta (pol delta), a eukaryotic polymerase required for DNA replication and DNA repair. WRN increases the rate of nucleotide incorporation by pol delta in the absence of proliferating cell nuclear antigen (PCNA) but does not stimulate the activity of eukaryotic DNA polymerases alpha or epsilon, or a variety of other DNA polymerases. Moreover, we show that functional interaction with WRN is mediated through the third subunit of pol delta: i.e., Pol32p of Saccharomyces cerevisae, corresponding to the recently identified p66 subunit of human pol delta. Absence of the third subunit abrogates stimulation by WRN, and stimulation is restored by reconstituting the three-subunit enzyme. Our findings suggest that WRN may facilitate pol delta-mediated DNA replication and/or DNA repair and that disruption of WRN-pol delta interaction in WS cells may contribute to the previously observed S-phase defects and/or the unusual sensitivity to a limited number of DNA damaging agents.

Base Sequence↗
PubMed2000

Microsatellite instability induced by hydrogen peroxide in Escherichia coli.

Damage to DNA by reactive oxygen species may be a significant source of endogenous mutagenesis in aerobic organisms. Using a selective assay for microsatellite instability in E. coli, we have asked whether endogenous oxidative mutagenesis can contribute to genetic instability. Instability of repetitive sequences, both in intronic sequences and within coding regions, is a hallmark of genetic instability in human cancers. We demonstrate that exposure of E. coli to low levels of hydrogen peroxide increases the frequency of expansions and deletions within dinucleotide repetitive sequences. Sequencing of the repetitive sequences and flanking non-repetitive regions in mutant clones demonstrated the high specificity for alterations with the repeats. All of the 183 mutants sequenced displayed frameshift alterations within the microsatellite repeats, and no base substitutions or frameshift mutations occurred within the flanking non-repetitive sequences. We hypothesize that endogenous oxidative damage to DNA can increase the frequency of strand slippage intermediates occurring during DNA replication or repair synthesis, and contribute to genomic instability.

Catalase↗
PubMed2000

Lethal mutagenesis of HIV by mutagenic ribonucleoside analogs.

The extraordinarily high mutation rate of HIV suggests that the viral population exists near the threshold for viral viability. An increase in mutation could mediate a lethal increase in the already high proportion of defective viruses. We initially tested this hypothesis by culturing HIV-infected cells in mutagenic deoxyribonucleoside analogs. In the presence of 5-hydroxydeoxycytidine, there was a loss of viral replication after sequential passages of HIV in human CEM cells (Loeb LA, et al.: Proc Natl Acad Sci USA 1999;96:14921497). We now propose to use mutagenic ribonucleosides to induce lethal mutagenesis. The incorporation of mutagenic analogs into the HIV genome by the host cell RNA polymerase, rather than by the viral reverse transcriptase, augurs well for the avoidance of resistant viruses.

Anti-HIV Agents↗
PubMed2000

The Werner syndrome gene: the molecular basis of RecQ helicase-deficiency diseases.

Werner syndrome (WS) is an autosomal recessive genetic disorder that is manifested by genetic instability and premature onset of age-related diseases, including atherosclerosis and cancer. The gene that is mutated in WS cells (WRN) has been identified recently. Characterizations of the WRN gene product indicate that WRN encodes both a 3'-->5' DNA helicase, belonging to the Escherichiacoli RecQ helicase family, and a 3'-->5' DNA exonuclease. Studies to define the molecular mechanism of WRN-DNA transactions are currently underway in many laboratories. Preliminary results indicate that WRN functions as a key factor in resolving aberrant DNA structures that arise from DNA metabolic processes such as replication, recombination and/or repair, to preserve the genetic integrity in cells.

Adenosine Triphosphatases↗
PubMed2000

Significance of multiple mutations in cancer.

There is increasing evidence that in eukaryotic cells, DNA undergoes continuous damage, repair and resynthesis. A homeostatic equilibrium exists in which extensive DNA damage is counterbalanced by multiple pathways for DNA repair. In normal cells, most DNA damage is repaired without error. However, in tumor cells this equilibrium may be skewed, resulting in the accumulation of multiple mutations. Among genes mutated are those that function in guaranteeing the stability of the genome. Loss of this stability results in a mutator phenotype. Evidence for a mutator phenotype in human cancers includes the frequent occurrence of gene amplification, microsatellite instability, chromosomal aberrations and aneuploidy. Current experiments have centered on two mechanisms for the generation of genomic instability, one focused on mutations in mismatch repair genes resulting in microsatellite instability, and one focused on mutations in genes that are required for chromosomal segregation resulting in chromosomal aberrations. This dichotomy may reflect only the ease by which these manifestations can be identified. Underlying both pathways may be a more general phenomenon involving the selection for mutator genes during tumor progression. During carcinogenesis there is selection for cells harboring mutations that can overcome adverse conditions that limit tumor growth. These mutations are produced by direct DNA damage as well as secondarily as a result of mutations in genes that cause a mutator phenotype. Thus, as tumor progression selects for cells with specific mutations, it also selects for cancer cells harboring mutations in genes that normally function in maintaining genetic instability.

Animals↗
PubMed2000

Enhanced in vivo repair of O(4)-methylthymine by a mutant human DNA alkyltransferase.

The repair of O(6)-methylguanine (m(6)G) by human O(6)-alkylguanine-DNA alkyltransferase (hAGT) is approximately 5000-fold greater than that for O(4)-methylthymine (m(4)T). To evaluate each adduct's contribution to mutagenesis, we previously created a mutant hAGT with increased specificity for m(4)T in vitro. The mutant and wild-type (WT) hAGT have now been expressed in bacterial strains that allow for the specific detection of A:T-->G:C and G:C-->A:T mutations induced by m(4)T and m(6)G, respectively. After exposure to the mutagenic methylating agent, N-methyl-N'-nitro-N-nitrosoguanidine, A:T-->G:C substitutions were reduced >4-fold in cells expressing the mutant hAGT compared with 1. 1-fold for WT hAGT. G:C-->A:T substitutions were decreased >2.5-fold in cells expressing the mutant hAGT, whereas WT hAGT totally prevented G:C-->A:T mutations. These results demonstrate that the altered substrate specificity of hAGT observed in vitro also occurs in vivo, and that it is responsible for the observed differences in mutations.

DNA Damage↗
PubMed1999

Tolerance of 5-fluorodeoxyuridine resistant human thymidylate synthases to alterations in active site residues.

Fluoropyrimidines, such as 5-fluorouracil (5-FU), are used extensively in cancer therapy. In the cell, 5-FU is metabolized to 5-fluorodeoxyuridylate (5-FdUMP), a tight binding covalent inhibitor of thymidylate synthase (TS). In order to create 5-FdUMP resistant enzymes to protect chemosensitive normal cells and further understand mechanisms of 5-FdUMP resistance, we have randomized four residues within the active site of TS. Our previous studies identified alterations in residues which produce active TS with enhanced resistance to 5-fluorouridine (5-FdUR). By remutagenizing a subset of the 13 previously targeted residues (A197, L198, C199 and V204), an unbiased random library can be created allowing for extensive testing of all possible amino acid substitutions at each of the sites. Using genetic complementation and selection in Escherichia coli, we identified the spectrum of substitutions that yield active TS as well as those that resulted in 5-FdUR resistant mutants of TS. The 5-FdUR resistant TS were found to share several structural features including hydrophobic substitutions at residue 197, retention of the wild-type leucine 198, the alteration C199L (present in 64% of the drug-resistant library), and polar alterations of valine 204. The catalytic activity of mutants with these features was approximately equal to that of the wild-type TS.

Amino Acid Substitution↗
PubMed1999

Redesigning the substrate specificity of human O(6)-alkylguanine-DNA alkyltransferase. Mutants with enhanced repair of O(4)-methylthymine.

Human O(6)-alkylguanine-DNA alkyltransferase (MGMT) repairs potentially cytotoxic and mutagenic alkylation damage at the O(6)-position of guanine and the O(4)-position of thymine in DNA. We have used random sequence mutagenesis and functional complementation to obtain human MGMT mutants that are resistant to the MGMT inhibitor, O(6)-benzylguanine [Encell, L. P., Coates, M. M., and Loeb, L. A. (1998) Cancer Res. 58, 1013-1020]. Here we describe screening of O(6)-benzylguanine-resistant mutants for altered substrate specificity, i.e., for an increased level of utilization of O(4)-methylthymine (m(4)T) relative to that of O(6)-methylguanine (m(6)G). One mutant identified by the screen, 56-8, containing eight substitutions near the active site (C150Y, S152R, A154S, V155G, N157T, V164M, E166Q, and A170T), was purified and characterized kinetically. The second-order rate constant for repair of m(4)T by the mutant was up to 11.5-fold greater than that of WT MGMT, and the relative m(4)T specificity, k(m(4)T)/k(m(6)G), was as much as 75-fold greater. In competition experiments with both substrates present, the mutant was 277-fold more sensitive to inhibition by m(4)T than WT MGMT. This mutant, and others like it, could help elucidate the complex relationship between adduction at specific sites in DNA and the cytotoxicity and mutagenicity of alkylating agents.

Amino Acid Substitution↗
PubMed1999

Detection of tandem CC-->TT mutations induced by oxygen radicals using mutation-specific PCR.

DNA lesions caused by reactive oxygen species (ROS) are considered to be one of the major contributors to DNA damage and mutagenesis. In this study, we developed a modification of allele-specific PCR to detect CC-->TT mutations caused by oxidative damage. These tandem mutations have been previously demonstrated to be indicative of oxygen damage in the absence of UV-irradiation. Using a CC target site in the rat DNA polymerase beta (pol beta) gene and a thermostable restriction enzyme that cuts the wild type sequence but not the TT mutation, we demonstrate that the TT mutation can be preferentially amplified from plasmid DNA damaged by oxygen radicals but not other DNA-damaging agents. We evaluated the potential utility of this assay in screening for mutations in cells and in analyzing those that arise during clonal proliferation in carcinogenesis.

DNA Damage↗
PubMed1999

Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n.

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.

Base Sequence↗
PubMed1999

Lethal mutagenesis of HIV with mutagenic nucleoside analogs.

The human immunodeficiency virus (HIV) replicates its genome and mutates at exceptionally high rates. As a result, the virus is able to evade immunological and chemical antiviral agents. We tested the hypothesis that a further increase in the mutation rate by promutagenic nucleoside analogs would abolish viral replication. We evaluated deoxynucleoside analogs for lack of toxicity to human cells, incorporation by HIV reverse transcriptase, resistance to repair when incorporated into the DNA strand of an RNA.DNA hybrid, and mispairing at high frequency. Among the candidates tested, 5-hydroxydeoxycytidine (5-OH-dC) fulfilled these criteria. In seven of nine experiments, the presence of this analog resulted in the loss of viral replicative potential after 9-24 sequential passages of HIV in human CEM cells. In contrast, loss of viral replication was not observed in 28 control cultures passaged in the absence of the nucleoside analog, nor with other analogs tested. Sequence analysis of a portion of the HIV reverse transcriptase gene demonstrated a disproportionate increase in G --> A substitutions, mutations predicted to result from misincorporation of 5-OH-dC into the cDNA during reverse transcription. Thus, "lethal mutagenesis" driven by the class of deoxynucleoside analogs represented by 5-OH-dC could provide a new approach to treating HIV infections and, potentially, other viral infections.

Antimetabolites↗
PubMed1999

Improving enzymes for cancer gene therapy.

New techniques now make it feasible to tailor enzymes for cancer gene therapy. Novel enzymes with desired properties can be created and selected from vast libraries of mutants containing random substitutions within catalytic domains. In this review, we first consider genes for the ablation of tumors, namely, genes that have been mutated (or potentially can be mutated) to afford enhanced activation of prodrugs and increased sensitization of tumors to specific chemotherapeutic agents. We then consider genes that have been mutated to provide better protection of normal host tissues, such as bone marrow, against the toxicity of specific chemotherapeutic agents. Expression of the mutant enzyme could render sensitive tissues, such as bone marrow, more resistant to specific cytotoxic agents.

Bone Marrow↗
PubMed1999

Human O(6)-alkylguanine-DNA alkyltransferase: protection against alkylating agents and sensitization to dibromoalkanes.

O(6)-alkylguanine-DNA alkyltransferase (AGT) is a suicide protein that corrects DNA damage by alkylating agents and may also serve to activate environmental carcinogens. We expressed human wild-type and two active mutant AGTs in bacteria that lack endogenous AGT and are also defective in nucleotide excision repair, to examine the ability of the AGTs to protect Escherichia coli from DNA damage by different types of alkylating agents and, oppositely, to sensitize cells to the genotoxic effects of dibromoalkanes (DBAs). Control bacteria carrying the cloning vector alone were extremely sensitive to mutagenesis by low, noncytotoxic doses of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). Expression of human wild-type AGT prevented most of this enlarged susceptibility to MNNG mutagenesis. Oppositely, cell killing required much higher MNNG concentrations and prevention by wild-type AGT was much less effective. Mutants V139F and V139F/P140R/L142M protected bacteria against MNNG-induced cytotoxicity more effectively than the wild-type AGT, but protection against the less stringent mutagenesis assay was variable. Subtle differences between wild-type AGT and the two mutant variants were further revealed by assaying protection against mutagenesis by more complex alkylating agents, such as N-ethyl-N-nitrosourea and 1-(2-chloro- ethyl)-3-cyclohexyl-1-nitrosourea. Unlike wild-type and V139F, the triple mutant variant, V139F/P140R/L142M was unaffected by the AGT inhibitor, O(6)-benzylguanine. Wild-type AGT and V139F potentiated the genotoxic effects of DBAs; however, the triple mutant virtually failed to sensitize the bacteria to these agents. These experiments provide evidence that in addition to the active site cysteine at position 145, the proline at position 140 might be important in defining the capacity by which AGTs modulate genotoxicity by environmentally relevant DBAs. The ability of AGTs to activate dibromoalkanes suggests that this DNA repair enzyme could be altered, and if expressed in tumors might be lethal by enhancing the activation of specific chemotherapeutic prodrugs.

Alkylating Agents↗
PubMed1998

Werner syndrome protein. I. DNA helicase and dna exonuclease reside on the same polypeptide.

Werner Syndrome (WS) is a human progeroid disorder characterized by genomic instability. The gene defective in WS encodes a 3' --> 5' DNA helicase (Gray, M. D., Shen, J.-C., Kamath-Loeb, A. S., Blank, A. , Sopher, B. L., Martin, G. M., Oshima, J., and Loeb, L. A.(1997) Nat. Genet. 17, 100-103). Sequence alignment analysis identified an N-terminal motif in WRN that is homologous to several exonucleases. Using combined molecular genetic, biochemical, and immunochemical approaches, we demonstrate that WRN also exhibits an integral DNA exonuclease activity. First, whereas wild-type recombinant WRN possesses both helicase and exonuclease activities, mutant WRN lacking the nuclease domain does not display exonucleolytic activity. In contrast, WRN proteins with defective helicase activity are active in exonucleolytic digestion of DNA. Second, the exonuclease co-purifies with the 160-kDa WRN protein and its associated DNA helicase and ATPase activities through successive steps of ion exchange and affinity chromatography, suggesting that all three activities are physically associated. Lastly, anti-WRN antiserum specifically co-precipitates the WRN helicase and exonuclease activities indicating that both activities reside on the same antigenic WRN polypeptide. The association of an exonuclease with WRN distinguishes it from other RecQ homologs and raises the possibility that the distinct phenotypic characteristics of WS may be due in part to a defective exonuclease.

Chromatography, Affinity↗
PubMed1998

Werner syndrome protein. II. Characterization of the integral 3' --> 5' DNA exonuclease.

In addition to its DNA helicase activity, Werner syndrome protein (WRN) also possesses an exonuclease activity (Shen, J.-C., Gray, M. D., Kamath-Loeb, A. S., Fry, M., Oshima, J., and Loeb, L. A. (1998) J. Biol. Chem. 273, 34139-34144). Here we describe the properties of nearly homogeneous WRN exonuclease. WRN exonuclease hydrolyzes a recessed strand in a partial DNA duplex but does not significantly digest single-stranded DNA, blunt-ended duplex, or a protruding strand of a partial duplex. Although DNA is hydrolyzed in the absence of nucleoside triphosphates, nuclease activity is markedly stimulated by ATP, dATP, or CTP. WRN exonuclease digests DNA with a 3' --> 5' directionality to generate 5'-dNMP products, and DNA strands terminating with either a 3'-OH or 3'-PO4 group are hydrolyzed to similar extents. A recessed DNA strand with a single 3'-terminal mismatch is hydrolyzed more efficiently by WRN than one with a complementary nucleotide, but the enzyme fails to hydrolyze a DNA strand terminating with two mismatched bases. WRN exonuclease is distinguished from known mammalian DNA nucleases by its covalent association with a DNA helicase, preference for a recessed DNA strand, stimulation by ATP, ability to equally digest DNA with 3'-OH or 3'-PO4 termini, and its preferential digestion of DNA with a single 3'-terminal mismatch.

Base Sequence↗
PubMed1998

Induction of microsatellite instability by oxidative DNA damage.

Instability of repetitive sequences, both in intronic sequences and within coding regions, has been demonstrated to be a hallmark of genomic instability in human cancer. Understanding how these mutational events arise may provide an opportunity for prevention or early intervention in cancer development. To study the source of this instability, we have identified a region of the beta-lactamase gene that is tolerant to the insertion of fragments of exogenous DNA as large as 1,614 bp with minimal loss of enzyme activity, as determined by antibiotic resistance. Fragments inserted out-of-frame render Escherichia coli sensitive to antibiotic, and compensatory frameshift mutations that restore the reading frame of beta-lactamase can be selected on the basis of antibiotic resistance. We have utilized this site to insert a synthetic microsatellite sequence within the beta-lactamase gene and selected for mutations yielding frameshifts. This assay provides for detection of one frameshift mutation in a background of 10(6) wild-type sequences. Mismatch repair deficiency increased the observed frameshift frequency approximately 300-fold. Exposure of plasmid containing microsatellite sequences to hydrogen peroxide resulted in frameshift mutations that were localized exclusively to the microsatellite sequences, whereas DNA damage by UV or N-methyl-N'-nitro-N-nitrosoguanidine did not result in enhanced mutagenesis. We postulate that in tumor cells, endogenous production of oxygen free radicals may be a major factor in promoting instability of microsatellite sequences. This beta-lactamase assay may provide a sensitive methodology for the detection and quantitation of mutations associated with the development of cancer.

Base Sequence↗