Biomedical subjects

Ken-ichi Kucho

Publications and source records attributed to Ken-ichi Kucho.

6 recordsLinked to original sources

PubMed2005

Global analysis of circadian expression in the cyanobacterium Synechocystis sp. strain PCC 6803.

Cyanobacteria are the only bacterial species found to have a circadian clock. We used DNA microarrays to examine circadian expression patterns in the cyanobacterium Synechocystis sp. strain PCC 6803. Our analysis identified 54 (2%) and 237 (9%) genes that exhibited circadian rhythms under stringent and relaxed filtering conditions, respectively. The expression of most cycling genes peaked around the time of transition from subjective day to night, suggesting that the main role of the circadian clock in Synechocystis is to adjust the physiological state of the cell to the upcoming night environment. There were several chromosomal regions where neighboring genes were expressed with similar circadian patterns. The physiological functions of the cycling genes were diverse and included a wide variety of metabolic pathways, membrane transport, and signal transduction. Genes involved in respiration and poly(3-hydroxyalkanoate) synthesis showed coordinated circadian expression, suggesting that the regulation is important for the supply of energy and carbon source in the night. Genes involved in transcription and translation also followed circadian cycling patterns. These genes may be important for output of the rhythmic information generated by the circadian clock. Our findings provided critical insights into the importance of the circadian clock on cellular physiology and the mechanism of clock-controlled gene regulation.

3-Hydroxybutyric Acid↗

PubMed2005

Improvement of the bioluminescence reporter system for real-time monitoring of circadian rhythms in the cyanobacterium Synechocystis sp. strain PCC 6803.

Circadian rhythm is a self-sustaining oscillation whose period length coincides with the 24-hour day-night cycle. A powerful tool for circadian clock research is the real-time automated bioluminescence monitoring system in which a promoter region of a clock-controlled gene is fused to a luciferase reporter gene and rhythmic regulation of the promoter activity is monitored as bioluminescence. In the present study, we greatly improved the bioluminescence reporter system in the cyanobacterium Synechocystis sp. strain PCC 6803. We fused an 805-bp promoter region of the dnaK gene seamlessly to the luxA coding sequence and integrated the P(dnaK)::luxAB fusion gene into a specific intergenic region of the Synechocystis genome (targeting site 1). The resulting new reporter strain, PdnaK::luxAB(-), showed 12 times the bioluminescence intensity of the standard reporter strain, CFC2. Furthermore, we generated strain PdnaK::luxAB(+), in which the P(dnaK)::luxAB fusion gene and the selection-marker spectinomycin resistance gene are transcribed in opposite directions. The PdnaK::luxAB(+) strain showed 19 times the bioluminescence intensity of strain CFC2. The procedures used to increase the bioluminescence intensity are especially useful for bioluminescence monitoring of genes with low promoter activity. In addition, these reporter constructs facilitate bioluminescence monitoring of any gene because the promoter fragments they contain can easily be replaced by digestion with unique restriction enzymes. They would therefore contribute to a genome-wide analysis of gene expression in Synechocystis.

Circadian Rhythm↗

PubMed2004

Determinants of sensitivity and specificity in spotted DNA microarrays with unmodified oligonucleotides.

DNA microarrays with unmodified oligonucleotides are a cost-effective alternative to cDNA microarrays. This study examined how purity, length, homology and GC content of the oligonucleotide probes influence the sensitivity and specificity of the method using cyanobacterial genes. Oligonucleotide purification by high pressure liquid chromatography was omitted without significant reduction in hybridization sensitivity. For two of three genes tested, a reduction in oligonucleotide length did not reduce hybridization sensitivity, and maximum sensitivity was achieved with probes that were 45 nt long. Oligonucleotide probes with <or=71% contiguous sequence identity to non-target DNA cross-hybridized with the sequences at a rate of < 8%. Cross-hybridization decreased as the GC content decreased from 65% to 55% or 35%. These results support the following criteria for selecting unmodified oligonucleotide probes that generate sensitive and specific microarrays: length of 45 nt, <or=71% identity to non-target sequences, and <or=55% GC content. In most of the bacterial species tested, oligonucleotide probes meeting these criteria were successfully designed for more than 95% of genes.

Base Sequence↗

PubMed2004

Construction of unmodified oligonucleotide-based microarrays in the thermophilic cyanobacterium Thermosynechococcus elongatus BP-1: screening of the candidates for circadianly expressed genes.

DNA microarrays with unmodified oligonucleotide probes are a cost-effective and high-performance alternative to cDNA microarrays. We searched every gene in the genome of the thermophilic cyanobacterium Thermosynechococcus elongatus BP-1 for 45-mer oligonucleotide probes with optimal nucleotide sequences, and found such probes in 90% of the genes. Using the probes, we constructed a microarray that represented 2,397 genes (95% of total genes). We detected only low signals in the negative control probes whose nucleotide sequences are not contained in the T. elongatus genome, demonstrating that specific hybridization occurred. To evaluate the reliability of the measurements obtained by the oligonucleotide microarray, we performed microarray experiments using RNA samples from two different time points of circadianly synchronized cultures, LL2 (early sub-jective day) and LL14 (early subjective night). Measurements obtained from the two independent microarray hybridizations were highly concordant (correlation coefficient [r] > 0.8). Northern blot analyses of 20 genes confirmed that expression changes detected by the microarrays were correct (r = 0.832). We identified 143 candidate clock-controlled genes whose expression levels at LL2 and LL14 were significantly different. Expression of 69 of them was enhanced at LL14 while expression of the other 74 was enhanced at LL2. The physiological functions of the genes were diverse and included metabolism, translation, transcription, membrane transport, DNA replication and repair, and cell growth and death.

Blotting, Northern↗

PubMed2003

Identification of a new cryptochrome class. Structure, function, and evolution.

Cryptochrome flavoproteins, which share sequence homology with light-dependent DNA repair photolyases, function as photoreceptors in plants and circadian clock components in animals. Here, we coupled sequencing of an Arabidopsis cryptochrome gene with phylogenetic, structural, and functional analyses to identify a new cryptochrome class (cryptochrome DASH) in bacteria and plants, suggesting that cryptochromes evolved before the divergence of eukaryotes and prokaryotes. The cryptochrome crystallographic structure, reported here for Synechocystis cryptochrome DASH, reveals commonalities with photolyases in DNA binding and redox-dependent function, despite distinct active-site and interaction surface features. Whole genome transcriptional profiling together with experimental confirmation of DNA binding indicated that Synechocystis cryptochrome DASH functions as a transcriptional repressor.

Amino Acid Sequence↗

PubMed2003

Cis-acting elements and DNA-binding proteins involved in CO2-responsive transcriptional activation of Cah1 encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii.

Expression of Cah1, encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii Dangeard, is activated when cells are exposed to low-CO2 conditions (0.04% [v/v]) in light. By using an arylsulfatase reporter gene, a regulatory region essential for the transcriptional activation of Cah1 was delimited to a 63-bp fragment between -293 and -231 relative to the transcription start site. Linker-scan analysis of the 63-bp region identified two enhancer elements, EE-1 (AGATTTTCACCGGTTGGAAGGAGGT) and EE-2 (CGACTTACGAA). Gel mobility shift assays indicated that nuclear extracts purified from cells grown under low-CO2 conditions in light contained DNA-binding proteins specifically interacting with EE-1 and EE-2. Gel mobility shift assays using mutant oligonucleotide probes revealed that the protein binding to EE-1 preferentially recognized a 9-bp sequence stretch (AGATTTTCA) of EE-1, containing a conserved sequence motif named EEC, GANTTNC, which is also present in EE-2. The EE-1- and EE-2-binding proteins interacted with the EECs contained in both of the two enhancer elements in vitro. Four EECs in the 5'-upstream region from -651 to -231 of Cah1 played a central role in the transcriptional activation of Cah1 under low-CO2 conditions. These EEC-binding proteins were present even in cells grown under high-CO2 conditions (5% [v/v]) or in the dark when Cah1 is not activated. On the basis of these results, the relationship between the transcriptional regulation of Cah1 and protein-binding to the enhancer elements in the 5'-upstream region of Cah1 is discussed.

Animals↗