Search PubMed⌕ Search

Biomedical subjects

K Wang

Publications and source records attributed to K Wang.

At least 559 records · Page 31Linked to original sources
PubMed1984

Effect of human tumor antigens on the active E-rosette-forming test (ARFT): a new diagnostic method for cancer.

The "active" T-cell test was adapted into an in vitro assay for response to human tumor antigens, especially gastric, lung, liver, esophageal, and colonic tumors. Peripheral blood lymphocytes were isolated from 229 cancer patients, 60 non-cancer patients, and 70 normal adults. Tumor antigen, incubated with lymphocytes from patients with the corresponding cancer, produced a significant increase in the ability of the lymphocytes to function as active rosette-forming cells (ARFC) when compared with lymphocytes cultured without antigen (P less than 0.001). This potentiating effect on ARFC remained unimpaired even after tumor antigen refrigeration. Tumor antigen incubated with lymphocytes from normal donors produced no increase in ARFC ability. This assay appears to be specific for the antigen corresponding to the cancer of the given patient; for example, gastric tumor antigen increased the ARFC of gastric cancer patients, but produced no increase in ARFC of breast cancer patients. No interference by the HLA complex was found in this assay. This technique provides a novel in vitro method for investigating cell-mediated immunity and also a new, specific method for cancer diagnosis.

Adult↗
PubMed1984

Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from agrobacterium to the plant genome.

We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome. The results indicate that the 25 bp T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action. A transfer-negative nononcogenic Ti plasmid derivative, pGV3852, was constructed, in which 3 kb covering the right T-DNA border region was substituted for by pBR322 sequences. The pBR322 sequences in pGV3852 provide a site for homologous recombination with pBR-derived plasmids containing sequences to assay for transfer activity. First, a 3.3 kb restriction fragment overlapping the deleted region in pGV3852 was shown to restore transfer activity. Second, a sequence of only 25 bp, the T-DNA terminus sequence, was shown to be sufficient to restore normal transfer activity. The transfer-promoting sequences are most active when reinserted in one orientation, that normally found in the Ti plasmid.

Base Sequence↗
PubMed1984

Titin is an extraordinarily long, flexible, and slender myofibrillar protein.

" Titin " is a term used to describe a pair of closely related megadalton polypeptides that together are the third most abundant myofibrillar protein in a wide range of striated muscles. It has been proposed that titin and another giant protein, nebulin , are the major components of an elastic cytoskeletal lattice within the sarcomere. We have now purified the leading band, titin -2 (T2), of the titin doublet in native forms by extraction with Guba -Straub solution followed by chromatography. Electron microscopy of low-angle-shadowed and negatively stained specimens revealed that T2 chains self-assembled into extremely long (from 0.1 micron to over 1.0 micron), flexible, and extensible slender strands (4-5 nm in diameter) with axial periodicity. Furthermore, these strands tended to associate to form filamentous bundles and meshworks. Thus, titin appears to be ideally suited as a component of an elastic lattice that serves as an organizing scaffold or template for thick and thin filaments.

Animals↗
PubMed1983

A network of transverse and longitudinal intermediate filaments is associated with sarcomeres of adult vertebrate skeletal muscle.

An extensive network of transverse and longitudinal filamentous bridges was revealed when small myofibril bundles, prepared from Triton-EGTA-treated rabbit skeletal muscles, were extracted with Kl to remove the majority of thin and thick filaments. Transmission and scanning electron microscopic studies of these salt-resistant cytoskeletal residues indicated (a) small bundles of short transverse filaments connect adjacent myofibrils by forming Z to Z and M to M bridges; (b) parallel, continuous longitudinal filaments connect the peripheries of successive Z-disks and ensheath the sarcomere. These transverse and longitudinal filaments have the characteristic morphology of intermediate filaments; (c) two rings of tightly interwoven and tangled filaments, connected laterally by short filaments, encircle each Z disk. This double-ring also encircles a weblike meshwork which penetrates the sarcomeric space. From the peripheries of these rings, transverse and longitudinal intermediate filaments emerge; and (d) a massive amount of material translocated and accumulated near Z disks during Kl extraction. The residues were fairly resistant to solubilization by urea and SDS, and complete dissolution was achieved only with guanidinium chloride. SDS PAGE indicated that the residues consisted mainly of titin, nebulin, and variable amounts of residual myosin and actin. Desmin represented only a few percent of total residual proteins; however, it may be a major component of the intermediate filament network. We suggest that the intermediate filament should be considered an integral sarcomeric component that may play important cytoskeletal roles in muscle structure and mechanics.

Animals↗
PubMed1982

Purification and properties of human platelet P235. A high molecular weight protein substrate of endogenous calcium-activated protease(s).

Two major high molecular weight proteins of human platelets are highly susceptible to proteolytic degradation by endogenous calcium-activated protease activities. Of the two proteins, one has been identified as filamin (Mr = 250,000 subunit); the second, a Mr = 235,000 subunit protein contributing 3-8% of the total platelet proteins, has not been previously characterized. We have now purified this protein, designated P235, to apparent homogeneity (greater than 95%). P235 was extracted by a Triton X-100 and EDTA containing buffer at pH 9.0 and purified by a series of DEAE-cellulose, phosphocellulose, and gel filtration chromatographies. Purified P235 is a dimer of Mr = 235,000 subunit. Its Stokes radius (67 A) and frictional ratio of 1.3 suggest that P235 is approximately globular. Despite this similarity in subunit and molecular weight of P235 to filamin, spectrin, fibronectin, and myosin, its amino acid composition, immunological properties, and peptide map are distinctly different and showed no precursor-product relationship to these proteins. Calcium-activated protease(s) in crude platelet extract rapidly degrade P235 into a Mr = 200,000 stable fragment. Upon prolonged storage at 4 degrees C, purified P235 partially degrades into a Mr = 220,000 and a Mr = 200,000 fragment. This degradation pattern suggests that P235 contains a large Mr = 200,000 protease-resistant domain. The availability of pure P235 will be useful in elucidating the functional role of this platelet protein, as well as the role of calcium-activated proteases in platelet function.

Amino Acid Sequence↗
PubMed1980

Identification of an N2 line protein of striated muscle.

Three unusually large myofibrillar proteins (Mr, > 500,000) are present in major amounts in the striated muscle of various species. the molecular properties and localization of two of these proteins (Mr, approximately 1 X 10(6)), named "titin," have been reported recently [Wang, K., McClure, J. & Tu, A.(1979) Proc. Natl. Acad. Sci. USA 76, 3698-3702]. We have now purified the third protein (Mr, approximately 5-6 X 10(5)), designated "band 3," from rabbit psoas myofibrils. Band 3 is distinct chemically and immunochemically from titin and myosin heavy chain. Immunofluorescent localization studies of band 3 in glycerinated rabbit psoas myofibrils indicated a biphasic distribution. In sarcomeres 1.8-3.7 micrometer long, band 3 is localized predominately on the N2 line in the phase-contrast lucent region of the I band. Quantitative analysis of light micrographs confirmed the unique behavior of N2 lines described in early electron microscopic studies. As the sarcomeres lengthen, the N2 line moves away from both the Z line and the M line, maintaining the same proportional distance. In very short sarcomeres (1.5-1.8 micrometer), band 3 is found mainly in the A band, suggesting that either the N2 line moves into the A band or that band 3 has dissociated from the N2 line which remains near the Z line. We conclude that band 3 is an N2 line component of rabbit skeletal myofibrils.

Animals↗
PubMed1979

Titin: major myofibrillar components of striated muscle.

Electrophoretic analyses of protein components of striated muscle myofibril purified from various vertebrate and invertebrate species revealed that proteins much larger than myosin heavy chain are present in significant amounts. To define possible roles of these heretofore unidentified proteins, we purified a combination of two uncommonly large proteins, designated as titin, from chicken breast myofibrils. Chemical and immunological studies indicated that titin is distinct from myosin, actin, and filamin. Specific titin anti body crossreacts with similar protein in both skeletal and cardiac myofibrils of many vertebrate and invertebrate species. Immunofluorescent staining of glycerinated chicken breast myofibrils indicated that titin is present in M lines, Z lines, the junctions of A and I bands, and perhaps throughout the entire A bands. Similar staining studies of myofibrils from other species suggest that titinlike proteins may be organized in all myofibrils according to a common architectural plan. We conclude that titin is a structurally conserved myofibrillar component of vertebrate and invertebrate striated muscles.

Animals↗